MAGEA12 (NM_001166386) Human Untagged Clone

CAT#: SC328506

MAGEA12 (untagged)-Human melanoma antigen family A 12 (MAGEA12) transcript variant 1


  "NM_001166386" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MAGEA12"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MAGEA12
Synonyms CT1.12; MAGE12
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001166386, the custom clone sequence may differ by one or more nucleotides
ATGCCACTTGAGCAGAGGAGTCAGCACTGCAAGCCTGAGGAAGGCCTTGAGGCCCAAGGA
GAGGCCCTGGGCTTGGTGGGTGCGCAGGCTCCTGCTACTGAGGAGCAGGAGACTGCCTCC
TCCTCCTCTACTCTAGTGGAAGTCACCCTGCGGGAGGTGCCTGCTGCCGAGTCACCAAGT
CCTCCCCACAGTCCTCAGGGAGCCTCCACCCTCCCCACTACCATCAACTATACTCTCTGG
AGTCAATCCGATGAGGGCTCCAGCAACGAAGAACAGGAAGGGCCAAGCACCTTTCCTGAC
CTGGAGACGAGCTTCCAAGTAGCACTCAGTAGGAAGATGGCTGAGTTGGTTCATTTTCTG
CTCCTCAAGTATCGAGCCAGGGAGCCATTCACAAAGGCAGAAATGCTGGGGAGTGTCATC
AGAAATTTCCAGGACTTCTTTCCTGTGATCTTCAGCAAAGCCTCCGAGTACTTGCAGCTG
GTCTTTGGCATCGAGGTGGTGGAAGTGGTCCGCATCGGCCACTTGTACATCCTTGTCACC
TGCCTGGGCCTCTCCTACGATGGCCTGCTGGGCGACAATCAGATCGTGCCCAAGACAGGC
CTCCTGATAATCGTCCTGGCCATAATCGCAAAAGAGGGCGACTGTGCCCCTGAGGAGAAA
ATCTGGGAGGAGCTGAGTGTGTTGGAGGCATCTGATGGGAGGGAGGACAGTGTCTTTGCG
CATCCCAGGAAGCTGCTCACCCAAGATTTGGTGCAGGAAAACTACCTGGAGTACCGGCAG
GTCCCCGGCAGTGATCCTGCATGCTACGAGTTCCTGTGGGGTCCAAGGGCCCTCGTTGAA
ACCAGCTATGTGAAAGTCCTGCACCATTTGCTAAAGATCAGTGGAGGACCTCACATTTCC
TACCCACCCCTGCATGAATGGGCTTTTAGAGAGGGGGAAGAGTGA
Restriction Sites Please inquire     
ACCN NM_001166386
ORF Size 945 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001166386.1, NP_001159858.1
RefSeq Size 1876
RefSeq ORF 945
Locus ID 4111
Gene Summary This gene is closely related to several other genes clustered on chromosome X. These genes may be overexpressed in tumors. Multiple alternatively spliced variants encoding the same protein have been identified. [provided by RefSeq, Jun 2014]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 all encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.