MAGEA8 (NM_001166401) Human Untagged Clone

CAT#: SC328517

MAGEA8 (untagged)-Human melanoma antigen family A 8 (MAGEA8) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MAGEA8
• Synonyms: CT1.8; MAGE8
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001166401, the custom clone sequence may differ by one or more nucleotides
  ATGCTTCTTGGGCAGAAGAGTCAGCGCTACAAGGCTGAGGAAGGCCTTCAGGCCCAAGGA
  GAGGCACCAGGGCTTATGGATGTGCAGATTCCCACAGCTGAGGAGCAGAAGGCTGCATCC
  TCCTCCTCTACTCTGATCATGGGAACCCTTGAGGAGGTGACTGATTCTGGGTCACCAAGT
  CCTCCCCAGAGTCCTGAGGGTGCCTCCTCTTCCCTGACTGTCACCGACAGCACTCTGTGG
  AGCCAATCCGATGAGGGTTCCAGCAGCAATGAAGAGGAGGGGCCAAGCACCTCCCCGGAC
  CCAGCTCACCTGGAGTCCCTGTTCCGGGAAGCACTTGATGAGAAAGTGGCTGAGTTAGTT
  CGTTTCCTGCTCCGCAAATATCAAATTAAGGAGCCGGTCACAAAGGCAGAAATGCTTGAG
  AGTGTCATCAAAAATTACAAGAACCACTTTCCTGATATCTTCAGCAAAGCCTCTGAGTGC
  ATGCAGGTGATCTTTGGCATTGATGTGAAGGAAGTGGACCCTGCCGGCCACTCCTACATC
  CTTGTCACCTGCCTGGGCCTCTCCTATGATGGCCTGCTGGGTGATGATCAGAGTACGCCC
  AAGACCGGCCTCCTGATAATCGTCCTGGGCATGATCTTAATGGAGGGCAGCCGCGCCCCG
  GAGGAGGCAATCTGGGAAGCGTTGAGTGTGATGGGGCTGTATGATGGGAGGGAGCACAGT
  GTCTATTGGAAGCTCAGGAAGCTGCTCACCCAAGAGTGGGTGCAGGAGAACTACCTGGAG
  TACCGCCAGGCGCCCGGCAGTGATCCTGTGCGCTACGAGTTCCTGTGGGGTCCAAGGGCC
  CTTGCTGAAACCAGCTATGTGAAAGTCCTGGAGCATGTGGTCAGGGTCAATGCAAGAGTT
  CGCATTTCCTACCCATCCCTGCATGAAGAGGCTTTGGGAGAGGAGAAAGGAGTTTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001166401
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001166401.1, NP_001159873.1
• RefSeq Size: 2111 bp
• RefSeq ORF: 957 bp
• Locus ID: 4107
• Cytogenetics: Xq28
• Gene Summary: 'This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Oct 2009]'
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 3 all encode the same protein.