VSIG4 (NM_001184830) Human Untagged Clone

CAT#: SC328528

VSIG4 (untagged)-Human V-set and immunoglobulin domain containing 4 (VSIG4) transcript variant 4


  "NM_001184830" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "VSIG4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol VSIG4
Synonyms CRIg; Z39IG
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001184830, the custom clone sequence may differ by one or more nucleotides


ATGGGGATCTTACTGGGCCTGCTACTCCTGGGGCACCTAACAGTGGACACTTATGGCCGTCCCATCCTGG
AAGTGCCAGAGAGTGTAACAGGACCTTGGAAAGGGGATGTGAATCTTCCCTGCACCTATGACCCCCTGCA
AGGCTACACCCAAGTCTTGGTGAAGTGGCTGGTACAACGTGGCTCAGACCCTGTCACCATCTTTCTACGT
GACTCTTCTGGAGACCATATCCAGCAGGCAAAGTACCAGGGCCGCCTGCATGTGAGCCACAAGGTTCCAG
GAGATGTATCCCTCCAATTGAGCACCCTGGAGATGGATGACCGGAGCCACTACACGTGTGAAGTCACCTG
GCAGACTCCTGATGGCAACCAAGTCGTGAGAGATAAGATTACTGAGCTCCGTGTCCAGAAACTCTCTGTC
TCCAAGCCCACAGTGACAACTGGCAGCGGTTATGGCTTCACGGTGCCCCAGGGAATGAGGATTAGCCTTC
AATGCCAGGCTCGGGGTTCTCCTCCCATCAGTTATATTTGGTATAAGCAACAGACTAATAACCAGGAACC
CATCAAAGTAGCAACCCTAAGTACCTTACTCTTCAAGCCTGCGGTGATAGCCGACTCAGGCTCCTATTTC
TGCACTGCCAAGGGCCAGGTTGGCTCTGAGCAGCACAGCGACATTGTGAAGTTTGTGGTCAAAGACTCCT
CAAAGCTACTCAAGACCAAGACTGAGGCACCTACAACCATGACATACCCCTTGAAAGCAACATCTACAGT
GAAGCAGTCCTGGGACTGGACCACTGACATGGATGGCTACCTTGGAGAGACCAGTGCTGGGCCAGGAAAG
AGCCTGCCTGTCTTTGCCATCATCCTCATCATCTCCTTGTGCTGTATGGTGGTTTTTACCATGGCCTATA
TCATGCTCTGTCGGAAGACATCCCAACAAGAGCATGTCTACGAAGCAGCCAGGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001184830
ORF Size 966 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001184830.1, NP_001171759.1
RefSeq Size 2209
RefSeq ORF 966
Locus ID 11326
Protein Families Transmembrane
Gene Summary This gene encodes a v-set and immunoglobulin-domain containing protein that is structurally related to the B7 family of immune regulatory proteins. The encoded protein may be a negative regulator of T-cell responses. This protein is also a receptor for the complement component 3 fragments C3b and iC3b. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Transcript Variant: This variant (4) differs in the 3' UTR and 3' coding region, compared to variant 1. The encoded isoform (4) has a shorter C-terminus, compared to isoform 4.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.