SSH3BP1 (ABI1) (NM_001178125) Human Untagged Clone

CAT#: SC328532

ABI1 (untagged)-Human abl-interactor 1 (ABI1) transcript variant 12

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ABI1
• Synonyms: ABI-1; ABLBP4; E3B1; NAP1BP; SSH3BP; SSH3BP1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001178125, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCAGAGCTGCAGATGTTACTAGAGGAGGAGATCCCGTCTGGCAAGAGGGCGCTGATCGAGAGTTACC
  AGAACCTGACTCGGGTGGCAGACTACTGTGAAAACAACTACATACAGGCTACAGACAAGAGAAAAGCTTT
  AGAGGAGACCAAAGCCTATACAACCCAATCTCTAGCTAGTGTTGCTTATCAAATAAATGCATTGGCCAAC
  AATGTACTCCAGTTGCTGGATATCCAAGCCTCTCAGCTTCGGAGAATGGAGTCTTCCATCAATCATATCT
  CACAGCATGGAAATAACCAGCCTGCAAGAACTGGCACACTGTCGAGAACAAATCCTCCTACTCAGAAACC
  GCCAAGTCCTCCCATGTCAGGCCGGGGAACACTGGGACGGAATACTCCTTATAAAACCCTGGAACCTGTT
  AAACCCCCAACAGTTCCTAATGACTATATGACCAGTCCTGCTAGGCTTGGAAGTCAGCATAGTCCAGGCA
  GGACAGCATCTTTAAATCAGAGACCAAGGACACACAGTGGAAGTAGTGGAGGAAGTGGAAGTCGAGAAAA
  CAGTGGTAGCAGTAGTATTGGCATTCCCATTGCTGTGCCTACACCTTCGCCACCCACTATTGGACCAGTT
  GCTGATAGTCCAACTCCACCGCCACCACCTCCACCAGATGACATTCCCATGTTTGATGACTCTCCACCTC
  CCCCACCACCACCACCAGTGGATTATGAAGATGAGGAGGCTGCAGTAGTTCAGTATAATGATCCATATGC
  AGATGGGGATCCTGCTTGGGCCCCCAAGAATTATATTGAGAAAGTTGTTGCAATATATGATTATACAAAA
  GACAAGGATGATGAGCTGTCATTTATGGAGGGTGCAATCATTTATGTTATAAAGAAGAATGATGATGGCT
  GGTATGAAGGAGTCTGCAATCGAGTGACTGGTCTGTTCCCTGGGAACTATGTTGAATCAATCATGCACTA
  TACTGATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001178125
• ORF Size: 990 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001178125.1, NP_001171596.1
• RefSeq Size: 3188
• RefSeq ORF: 990
• Locus ID: 10006
• Gene Summary: This gene encodes a member of the Abelson-interactor family of adaptor proteins. These proteins facilitate signal transduction as components of several multiprotein complexes, and regulate actin polymerization and cytoskeletal remodeling through interactions with Abelson tyrosine kinases. The encoded protein plays a role in macropinocytosis as a component of the WAVE2 complex, and also forms a complex with EPS8 and SOS1 that mediates signal transduction from Ras to Rac. This gene may play a role in the progression of several malignancies including melanoma, colon cancer and breast cancer, and a t(10;11) chromosomal translocation involving this gene and the MLL gene has been associated with acute myeloid leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 14. [provided by RefSeq, Sep 2011]
  Transcript Variant: This variant (12) lacks five alternate in-frame coding exons, compared to variant 1. The resulting protein (isoform l) has the same N- and C-termini but is shorter when it is compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.