PDHB (NM_001173468) Human Untagged Clone
CAT#: SC328545
PDHB (untagged)-Human pyruvate dehydrogenase (lipoamide) beta (PDHB) nuclear gene encoding mitochondrial protein transcript variant 2
"NM_001173468" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PDHB |
Synonyms | PDHBD; PDHE1-B; PDHE1B; PHE1B |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001173468, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGGGAGGTCTCCGGGCTGCTGAAGAGGCGCTTTC ACTGGACCGCGCCGGCTGCGCTGCAGGTGACAGTTCGTGATGCTATAAATCAGGGTATGGATGAGGAGCT GGAAAGAGATGAGAAGGTATTTCTGCTTGGAGAAGAAGTTGCCCAGTATGATGGGGCATACAAGGTTAGT CGAGGGCTGTGGAAGAAATATGGAGACAAGAGGATTATTGACACTCCCATATCAGAGATGGGCTTTGCTG GAATTGCTGTAGGTGCAGCTATGGCTGGGTTGCGGCCCATTTGTGAATTTATGACCTTCAATTTCTCCAT GCAAGCCATTGACCAGGTTATAAACTCAGCTGCCAAGACCTACTACATGTCTGGTGTAGCTGCCCAGCAC TCACAGTGCTTTGCTGCCTGGTATGGGCACTGCCCAGGCTTAAAGGTGGTCAGTCCCTGGAATTCAGAGG ATGCTAAAGGACTTATTAAATCAGCCATTCGGGATAACAATCCAGTGGTGGTGCTAGAGAATGAATTGAT GTATGGGGTTCCTTTTGAATTTCCTCCGGAAGCTCAGTCAAAAGATTTTCTGATTCCTATTGGAAAAGCC AAAATAGAAAGGCAAGGAACACATATAACTGTGGTTTCCCATTCAAGACCTGTGGGCCACTGCTTAGAAG CTGCAGCAGTGCTATCTAAAGAAGGAGTTGAATGTGAGGTGATAAATATGCGTACCATTAGACCAATGGA CATGGAAACCATAGAAGCCAGTGTCATGAAGACAAATCATCTTGTAACTGTGGAAGGAGGCTGGCCACAG TTTGGAGTAGGAGCTGAAATCTGTGCCAGGATCATGGAAGGTCCTGCGTTCAATTTCCTGGATGCTCCTG CTGTTCGTGTCACTGGTGCTGATGTCCCTATGCCTTATGCAAAGATTCTAGAGGACAACTCTATACCTCA GGTCAAAGACATCATATTTGCAATAAAGAAAACATTAAATATTTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001173468 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001173468.1, NP_001166939.1 |
RefSeq Size | 1490 bp |
RefSeq ORF | 1026 bp |
Locus ID | 5162 |
Cytogenetics | 3p14.3 |
Protein Pathways | Butanoate metabolism, Citrate cycle (TCA cycle), Glycolysis / Gluconeogenesis, Metabolic pathways, Pyruvate metabolism, Valine, leucine and isoleucine biosynthesis |
Gene Summary | 'The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and carbon dioxide, and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 beta subunit. Mutations in this gene are associated with pyruvate dehydrogenase E1-beta deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2012]' Transcript Variant: This variant (2) lacks a segment in the coding region compared to variant 1. The resulting protein (isoform 2) is shorter but has the same N- and C-termini compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229907 | PDHB (Myc-DDK-tagged)-Human pyruvate dehydrogenase (lipoamide) beta (PDHB), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 420.00 |
|
RG229907 | PDHB (GFP-tagged) - Human pyruvate dehydrogenase (lipoamide) beta (PDHB), nuclear gene encoding mitochondrial protein, transcript variant 2 |
USD 460.00 |
|
RC229907L3 | Lenti ORF clone of Human pyruvate dehydrogenase (lipoamide) beta (PDHB), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC229907L4 | Lenti ORF clone of Human pyruvate dehydrogenase (lipoamide) beta (PDHB), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review