PDHB (NM_001173468) Human Untagged Clone

CAT#: SC328545

PDHB (untagged)-Human pyruvate dehydrogenase (lipoamide) beta (PDHB) nuclear gene encoding mitochondrial protein transcript variant 2


  "NM_001173468" in other vectors (4)

Reconstitution Protocol

USD 580.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PDHB"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PDHB
Synonyms PDHBD; PDHE1-B; PDHE1B; PHE1B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001173468, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCGGTGTCTGGCTTGGTGCGGAGACCCCTTCGGGAGGTCTCCGGGCTGCTGAAGAGGCGCTTTC
ACTGGACCGCGCCGGCTGCGCTGCAGGTGACAGTTCGTGATGCTATAAATCAGGGTATGGATGAGGAGCT
GGAAAGAGATGAGAAGGTATTTCTGCTTGGAGAAGAAGTTGCCCAGTATGATGGGGCATACAAGGTTAGT
CGAGGGCTGTGGAAGAAATATGGAGACAAGAGGATTATTGACACTCCCATATCAGAGATGGGCTTTGCTG
GAATTGCTGTAGGTGCAGCTATGGCTGGGTTGCGGCCCATTTGTGAATTTATGACCTTCAATTTCTCCAT
GCAAGCCATTGACCAGGTTATAAACTCAGCTGCCAAGACCTACTACATGTCTGGTGTAGCTGCCCAGCAC
TCACAGTGCTTTGCTGCCTGGTATGGGCACTGCCCAGGCTTAAAGGTGGTCAGTCCCTGGAATTCAGAGG
ATGCTAAAGGACTTATTAAATCAGCCATTCGGGATAACAATCCAGTGGTGGTGCTAGAGAATGAATTGAT
GTATGGGGTTCCTTTTGAATTTCCTCCGGAAGCTCAGTCAAAAGATTTTCTGATTCCTATTGGAAAAGCC
AAAATAGAAAGGCAAGGAACACATATAACTGTGGTTTCCCATTCAAGACCTGTGGGCCACTGCTTAGAAG
CTGCAGCAGTGCTATCTAAAGAAGGAGTTGAATGTGAGGTGATAAATATGCGTACCATTAGACCAATGGA
CATGGAAACCATAGAAGCCAGTGTCATGAAGACAAATCATCTTGTAACTGTGGAAGGAGGCTGGCCACAG
TTTGGAGTAGGAGCTGAAATCTGTGCCAGGATCATGGAAGGTCCTGCGTTCAATTTCCTGGATGCTCCTG
CTGTTCGTGTCACTGGTGCTGATGTCCCTATGCCTTATGCAAAGATTCTAGAGGACAACTCTATACCTCA
GGTCAAAGACATCATATTTGCAATAAAGAAAACATTAAATATTTAG


Restriction Sites SgfI-MluI     
ACCN NM_001173468
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001173468.1, NP_001166939.1
RefSeq Size 1490 bp
RefSeq ORF 1026 bp
Locus ID 5162
Cytogenetics 3p14.3
Protein Pathways Butanoate metabolism, Citrate cycle (TCA cycle), Glycolysis / Gluconeogenesis, Metabolic pathways, Pyruvate metabolism, Valine, leucine and isoleucine biosynthesis
Gene Summary 'The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and carbon dioxide, and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. The PDH complex is composed of multiple copies of three enzymatic components: pyruvate dehydrogenase (E1), dihydrolipoamide acetyltransferase (E2) and lipoamide dehydrogenase (E3). The E1 enzyme is a heterotetramer of two alpha and two beta subunits. This gene encodes the E1 beta subunit. Mutations in this gene are associated with pyruvate dehydrogenase E1-beta deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2012]'
Transcript Variant: This variant (2) lacks a segment in the coding region compared to variant 1. The resulting protein (isoform 2) is shorter but has the same N- and C-termini compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.