BRUNOL6 (CELF6) (NM_001172685) Human Untagged Clone

CAT#: SC328552

CELF6 (untagged)-Human CUGBP Elav-like family member 6 (CELF6) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CELF6
• Synonyms: BRUNOL6
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001172685, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAATCGTCCGATCCAAGTGAAGCCAGCTGCCAGTGAGGGCCGAGGAGAGGACCGAAAGCTGTTTGTGG
  GGATGCTGGGCAAGCAGCAGGGTGAGGAGGACGTCAGACGCCTGTTCCAGCCCTTTGGCCACATCGAGGA
  GTGCACGGTCCTGCGGAGTCCTGACGGCACCAGTAAAGGCTGTGCCTTTGTGAAGTTCGGGAGTCAAGGG
  GAAGCTCAGGCGGCCATCCGGGGTCTGCACGGCAGCCGGACCATGGCGGGCGCCTCGTCCAGCCTCGTGG
  TCAAGCTGGCGGACACCGACCGGGAGCGCGCGCTGCGGCGGATGCAGCAGATGGCCGGCCACCTGGGCGC
  CTTCCACCCCGCGCCACTGCCGCTAGGGGCCTGCGGCGCCTACACCACGGCGATCCTGCAGCACCAGGCG
  GCCCTGCTGGCGGCGGCACAGGGCCCAGGCCTAGGCCCGGTGGCGGCAGTGGCGGCCCAGATGCAACACG
  TGGCGGCCTTTAGCCTGGTAGCTGCGCCTCTGTTGCCCGCGGCAGCCAACTCCCCGCCTGGCAGCGGCCC
  TGGCACCCTCCCAGGTCTTCCGGCGCCCATCGGGGTCAATGGATTCGGCCCTCTGACCCCCCAGACCAAT
  GGCCAGCCGGGCTCCGACACGCTCTACAATAACGGGCTCTCCCCTTATCCAGCAGCCTATCCGTCGGCCT
  ATGCCCCAGTGAGCACAGCTTTTCCCCAGCAGCCTTCAGCCCTGCCCCAGCAGCAGAGAGAAGGCCCCGA
  AGGCTGTAACCTCTTCATCTATCACCTGCCTCAGGAGTTTGGTGATGCGGAACTCATACAGACATTCCTG
  CCCTTTGGAGCCGTTGTCTCTGCTAAAGTCTTTGTGGATCGAGCCACCAACCAGAGCAAGTGTTTTGGGT
  TTGTTAGTTTTGACAATCCAACTAGTGCCCAGACTGCTATTCAGGCGATGAATGGCTTTCAAATTGGCAT
  GAAGAGGCTCAAGGTCCAGCTAAAGCGGCCCAAGGATGCCAACCGGCCTTACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001172685
• ORF Size: 1035 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001172685.1, NP_001166156.1
• RefSeq Size: 2854
• RefSeq ORF: 1035
• Locus ID: 60677
• Gene Summary: Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
  Transcript Variant: This variant (3) has an alternate 5' sequence, which results in a downstream AUG start codon, and lacks an in-frame coding exon, as compared to variant 1. The resulting isoform (3) has a shorter N-terminus and lacks an internal segment, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.