KIST (UHMK1) (NM_144624) Human Untagged Clone

CAT#: SC328553

UHMK1 (untagged)-Human U2AF homology motif (UHM) kinase 1 (UHMK1) transcript variant 3


  "NM_144624" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "UHMK1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UHMK1
Synonyms KIS; KIST; P-CIP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_144624, the custom clone sequence may differ by one or more nucleotides


ATGGCGGGATCCGGCTGCGCCTGGGGCGCGGAGCCGCCGCGTTTTCTGGAGGCCTTCGGGCGGCTGTGGC
AGGTACAGAGCCGTCTGGGTAGCGGCTCCTCCGCCTCGGTGTATCGGGTTCGCTGCTGCGGCAACCCTGG
CTCGCCCCCCGGCGCCCTCAAGCAGTTCTTGCCGCCAGGAACCACCGGGGCTGCGGCCTCTGCCGCCGAG
TATGGTTTCCGCAAAGAGAGGGCGGCGCTGGAACAGTTGCAGGGTCACAGAAACATCGTGACTTTGTATG
GAGTGTTTACAATCCACTTTTCTCCAAATGTGCCATCACGCTGTCTGTTGCTTGAACTCCTGGATGTCAG
TGTTTCGGAATTGCTCTTATATTCCAGTCACCAGGGTTGTTCCATGTGGATGATACAGCATTGTGCCCGA
GATGTTTTGGAGGCCCTTGCTTTTCTTCATCATGAGGGCTATGTCCATGCGGACCTCAAACCACGTAACA
TATTGTGGAGTGCAGAGAATGAATGTTTTAAACTCATTGACTTTGGACTTAGCTTCAAAGAAGGCAATCA
GGATGTAAAGTATATTCAGACAGACGGGTATCGGGCTCCAGAAGCAGAATTGCAAAATTGCTTGGCCCAG
GCTGGCCTGCAGAGTGATACAGAATGTACCTCAGCTGTTGATCTGTGGAGCCTAGGAATCATTTTACTGG
AAATGTTCTCAGGAATGAAACTGAAACATACAGTCAGATCTCAGGAATGGAAGGCAAACAGTTCTGCTAT
TATTGATCACATATTTGCCAGTAAAGCAGTGGTGAATGCCGCAATTCCAGCCTATCACCTAAGAGACCTT
ATCAAAAGCATGCTTCATGATGATCCAAGCAGAAGAATTCCTGCTGAAATGGCATTGTGCAGCCCATTCT
TTAGCATTCCTTTTGCCCCTCATATTGAAGATCTGGTCATGCTTCCCACTCCAGTGCTAAGACTGCTGAA
TGTGCTGGATGATGATTATCTTGAGAATGAAGAGGAATATGAAGGTCTTTGTTGA


Restriction Sites SgfI-MluI     
ACCN NM_144624
ORF Size 1035 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_144624.2, NP_653225.2
RefSeq Size 8446
RefSeq ORF 1035
Locus ID 127933
Domains pkinase, TyrKc, S_TKc
Protein Families Druggable Genome, Protein Kinase
Gene Summary The gene encodes a serine/threonine protein kinase that promotes cell cycle progression through G1 by phosphorylation of the cyclin-dependent kinase inhibitor 1B (p27Kip1), which causes nuclear export and degradation. The encoded protein is also thought to function in the adult nervous system and the gene has been associated with schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Transcript Variant: This variant (3) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded protein (isoform 3) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.