KIST (UHMK1) (NM_001184763) Human Untagged Clone
CAT#: SC328554
UHMK1 (untagged)-Human U2AF homology motif (UHM) kinase 1 (UHMK1) transcript variant 2
"NM_001184763" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | UHMK1 |
Synonyms | KIS; KIST; P-CIP2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001184763, the custom clone sequence may differ by one or more nucleotides
ATGTTTCTTACCAGACCGAAGGTCTGTGTTGACCTTAACCGGAGAGTGACTTTGTATGGAGTGTTTACAA TCCACTTTTCTCCAAATGTGCCATCACGCTGTCTGTTGCTTGAACTCCTGGATGTCAGTGTTTCGGAATT GCTCTTATATTCCAGTCACCAGGGTTGTTCCATGTGGATGATACAGCATTGTGCCCGAGATGTTTTGGAG GCCCTTGCTTTTCTTCATCATGAGGGCTATGTCCATGCGGACCTCAAACCACGTAACATATTGTGGAGTG CAGAGAATGAATGTTTTAAACTCATTGACTTTGGACTTAGCTTCAAAGAAGGCAATCAGGATGTAAAGTA TATTCAGACAGACGGGTATCGGGCTCCAGAAGCAGAATTGCAAAATTGCTTGGCCCAGGCTGGCCTGCAG AGTGATACAGAATGTACCTCAGCTGTTGATCTGTGGAGCCTAGGAATCATTTTACTGGAAATGTTCTCAG GAATGAAACTGAAACATACAGTCAGATCTCAGGAATGGAAGGCAAACAGTTCTGCTATTATTGATCACAT ATTTGCCAGTAAAGCAGTGGTGAATGCCGCAATTCCAGCCTATCACCTAAGAGACCTTATCAAAAGCATG CTTCATGATGATCCAAGCAGAAGAATTCCTGCTGAAATGGCATTGTGCAGCCCATTCTTTAGCATTCCTT TTGCCCCTCATATTGAAGATCTGGTCATGCTTCCCACTCCAGTGCTAAGACTGCTGAATGTGCTGGATGA TGATTATCTTGAGAATGAAGAGGAATATGAAGATGTTGTAGAAGATGTAAAAGAGGAGTGTCAAAAATAT GGACCAGTGGTATCTCTACTTGTTCCAAAGGAAAATCCTGGCAGAGGACAAGTCTTTGTTGAGTATGCAA ATGCTGGTGATTCCAAAGCTGCGCAGAAATTACTGACTGGAAGGATGTTTGATGGGAAGTTTGTTGTGGC TACATTCTACCCGCTGAGTGCCTACAAGAGGGGATATCTGTATCAAACCTTGCTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001184763 |
ORF Size | 1038 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001184763.1, NP_001171692.1 |
RefSeq Size | 8194 |
RefSeq ORF | 1038 |
Locus ID | 127933 |
Protein Families | Druggable Genome, Protein Kinase |
Gene Summary | The gene encodes a serine/threonine protein kinase that promotes cell cycle progression through G1 by phosphorylation of the cyclin-dependent kinase inhibitor 1B (p27Kip1), which causes nuclear export and degradation. The encoded protein is also thought to function in the adult nervous system and the gene has been associated with schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010] Transcript Variant: This variant (2) differs in the 5' UTR and initiates translation at an alternate start codon, compared to variant 1. The resulting protein (isoform 2) is shorter and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229916 | UHMK1 (Myc-DDK-tagged)-Human U2AF homology motif (UHM) kinase 1 (UHMK1), transcript variant 2 |
USD 420.00 |
|
RG229916 | UHMK1 (GFP-tagged) - Human U2AF homology motif (UHM) kinase 1 (UHMK1), transcript variant 2 |
USD 460.00 |
|
RC229916L3 | Lenti ORF clone of Human U2AF homology motif (UHM) kinase 1 (UHMK1), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC229916L4 | Lenti ORF clone of Human U2AF homology motif (UHM) kinase 1 (UHMK1), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review