ELAVL2 (NM_001171197) Human Untagged Clone

CAT#: SC328557

ELAVL2 (untagged)-Human ELAV (embryonic lethal abnormal vision Drosophila)-like 2 (Hu antigen B) (ELAVL2) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ELAVL2
• Synonyms: HEL-N1; HELN1; HUB
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001171197, the custom clone sequence may differ by one or more nucleotides
  ATGGAAACACAACTGTCTAATGGGCCAACTTGCAATAACACAGCCAATGGTCCAACCACC
  ATAAACAACAACTGTTCGTCACCAGTTGACTCTGGGAACACAGAAGACAGCAAGACCAAC
  TTAATAGTCAACTACCTTCCTCAGAACATGACACAGGAGGAACTAAAGAGTCTCTTTGGG
  AGCATTGGTGAAATAGAGTCCTGTAAGCTTGTAAGAGACAAAATAACAGGGCAGAGCTTG
  GGATATGGCTTTGTGAACTACATTGACCCCAAGGATGCAGAGAAAGCTATCAACACCCTG
  AATGGATTGAGACTTCAAACCAAAACAATAAAAGTTTCCTATGCTCGCCCAAGTTCAGCT
  TCTATCAGAGATGCAAATTTATATGTCAGCGGACTTCCAAAAACAATGACCCAGAAGGAG
  TTGGAACAGCTTTTTTCACAATATGGACGCATTATTACTTCTCGTATTCTTGTCGACCAG
  GTCACTGGCATATCAAGGGGTGTAGGGTTTATTCGATTTGACAAGCGAATTGAGGCAGAA
  GAAGCTATCAAAGGCCTAAATGGCCAGAAACCTCCCGGTGCCACGGAGCCAATCACTGTA
  AAGTTTGCTAATAACCCAAGCCAAAAAACCAATCAGGCCATCCTTTCCCAGCTGTACCAG
  TCTCCAAACAGAAGGTATCCAGGACCGCTAGCTCAGCAGGCACAGCGTTTTAGGTTTTCT
  CCAATGACCATTGACGGAATGACCAGTTTGGCTGGAATTAATATCCCTGGGCACCCTGGA
  ACAGGGTGGTGTATATTTGTGTACAACCTGGCTCCTGACGCAGATGAGAGTATCCTGTGG
  CAAATGTTTGGGCCTTTTGGAGCTGTCACCAATGTGAAGGTCATCCGTGACTTTAACACC
  AATAAATGCAAAGGTTTTGGATTTGTGACTATGACAAACTATGATGAGGCTGCCATGGCG
  ATAGCTAGCCTCAATGGATACCGTCTGGGAGACAGAGTACTGCAGGTCTCCTTTAAGACA
  AACAAAACGCACAAAGCCTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001171197
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001171197.1, NP_001164668.1
• RefSeq Size: 3769 bp
• RefSeq ORF: 1041 bp
• Locus ID: 1993
• Cytogenetics: 9p21.3
• Protein Families: Transcription Factors
• Gene Summary: 'In humans, the ELAV like RNA binding protein gene family has four members (ELAVL1-4). ELAVL RNA binding proteins recognize AU-rich elements in the 3' UTRs of gene transcripts and thereby regulate gene expression post-transcriptionally. The protein encoded by this gene binds to several 3' UTRs, including its own and also that of FOS, ID, and POU5F1. This gene encodes ELAVL2 and, like ELAVL3 and ELAVL4, is expressed specifically in neurons and primarily localizes to the cytoplasm. This protein also forms a cytosolic complex with the normally nuclear-localized ELAVL1 protein. Alternative splicing of this gene results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Jul 2020]'
  Transcript Variant: This variant (3) differs in the 5' UTR and lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Variants 2, 3, 26 and 27 encode the same protein (isoform b).