CHST11 (NM_001173982) Human Untagged Clone

CAT#: SC328560

CHST11 (untagged)-Human carbohydrate (chondroitin 4) sulfotransferase 11 (CHST11) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CHST11
• Synonyms: C4ST; C4ST-1; C4ST1; HSA269537; OCBMD
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001173982, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGCCAGCGCTGCTGGAAGTGATGAGGATGAACAGAATCTGCCGGATGGTGCTGGCCACTTGCTTGG
  GATCCTTTATCCTGGTCATCTTCTATTTCCAAATCATGCGGAGGAATCCCTTTGGTGTGGACATCTGCTG
  CCGGAAGGGGTCCCGAAGCCCCCTGCAGGAACTCTACAACCCAATCCAGCTGGAGCTCTCAAACACTGCT
  GTCCTGCACCAGATGCGGCGGGACCAGGTGACAGACACGTGCCGAGCCAACAGCGCCACAAGCCGTAAGC
  GGAGGGTGCTGACCCCCAACGACCTGAAGCACTTGGTGGTGGATGAGGACCACGAGCTCATCTACTGCTA
  CGTGCCCAAGGTGGCCTGCACCAACTGGAAGCGGCTCATGATGGTCCTGACCGGGCGGGGGAAGTACAGC
  GACCCCATGGAGATCCCGGCCAACGAGGCACACGTCTCCGCCAACCTGAAGACCCTGAACCAGTACAGCA
  TCCCAGAAATCAACCACCGCTTGAAAAGCTACATGAAGTTCCTGTTTGTCCGGGAGCCCTTCGAGAGGCT
  AGTGTCCGCCTACCGCAACAAGTTCACCCAGAAGTACAACATCTCCTTCCACAAGCGGTACGGCACCAAG
  ATCATCAAACGCCAGCGGAAGAACGCCACCCAGGAGGCCCTGCGCAAAGGGGACGATGTCAAATTCGAGG
  AGTTTGTGGCCTATCTCATCGACCCACACACCCAGCGGGAGGAGCCTTTCAACGAACACTGGCAAACCGT
  CTACTCACTCTGCCATCCCTGCCACATCCACTATGACCTCGTGGGCAAGTACGAGACACTGGAAGAGGAT
  TCTAATTACGTCCTGCAGCTGGCAGGAGTGGGCAGCTACCTGAAGTTCCCCACCTATGCAAAGTCTACGA
  GAACTACTGATGAAATGACCACAGAATTCTTCCAGAACATCAGCTCAGAGCACCAAACGCAGCTGTACGA
  AGTCTACAAACTCGATTTTTTAATGTTCAATTACTCAGTGCCAAGCTACCTGAAATTGGAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001173982
• ORF Size: 1044 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001173982.1, NP_001167453.1
• RefSeq Size: 5753
• RefSeq ORF: 1044
• Locus ID: 50515
• Protein Families: Transmembrane
• Protein Pathways: Chondroitin sulfate biosynthesis, Sulfur metabolism
• Gene Summary: The protein encoded by this gene belongs to the sulfotransferase 2 family. It is localized to the golgi membrane, and catalyzes the transfer of sulfate to position 4 of the N-acetylgalactosamine (GalNAc) residue of chondroitin. Chondroitin sulfate constitutes the predominant proteoglycan present in cartilage, and is distributed on the surfaces of many cells and extracellular matrices. A chromosomal translocation involving this gene and IgH, t(12;14)(q23;q32), has been reported in a patient with B-cell chronic lymphocytic leukemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
  Transcript Variant: This variant (2) uses an alternate in-frame donor splice site at the 5' terminal exon compared to variant 1. This results in a shorter isoform (2) missing a 5 aa protein segment near the N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.