FBXL2 (NM_001171713) Human Untagged Clone
CAT#: SC328567
FBXL2 (untagged)-Human F-box and leucine-rich repeat protein 2 (FBXL2) transcript variant 2
"NM_001171713" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FBXL2 |
Synonyms | FBL2; FBL3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001171713, the custom clone sequence may differ by one or more nucleotides
ATGGTTTTCTCAAACAATGATGAAGGCCTTATTAACAAAAAGTTACCCAAAGAACTTCTGTTAAGAATAT TTTCCTTCTTGGATATAGTAACTTTGTGCCGATGTGCACAGATTTCCAAGGCTTGGAACATCTTAGCCCT GGATGGAAGCAACTGGCAAAGAATAGATCTTTTTAACTTTCAAACAGATGTAGAGGGTCGAGTGGTGGAA AATATCTCGAAGCGATGCGGTGGATTCCTGAGGAAGCTCAGCTTGCGAGGCTGCATTGGTGTTGGGGATT CCTCCTTGAAGACCTTTGCACAGAACTGCCGAAACATTGAACATTTGAACCTCAATGGATGCACAAAAAT CACTGACAGCACGTGTTATAGCCTTAGCAGATTCTGTTCCAAGCTGAAACACATTCAGAATTACTGCCAT GAGCTTGTGAGCCTCAACTTGCAGTCCTGCTCACGTATCACGGATGAAGGTGTGGTGCAGATATGCAGGG GCTGTCACCGGCTACAGGCTCTCTGCCTTTCGGGTTGCAGCAACCTCACAGATGCCTCTCTTACAGCCCT GGGTTTGAACTGTCCGCGACTGCAAATTTTGGAGGCTGCCCGATGCTCCCATTTGACTGACGCAGGTTTT ACACTTTTAGCTCGGAATTGCCACGAATTGGAGAAGATGGATCTTGAAGAATGCATCCTGATAACCGACA GCACACTCATCCAGCTCTCCATTCACTGTCCTAAACTGCAAGCCCTGAGCCTGTCCCACTGTGAACTCAT CACAGATGATGGGATCCTGCACCTGAGCAACAGTACCTGTGGCCATGAGAGGCTGCGGGTACTGGAGTTG GACAACTGCCTCCTCATCACTGATGTGGCCCTGGAACACCTAGAGAACTGCCGAGGCCTGGAGCGCCTCG AGCTGTACGACTGCCAGCAGGTTACCCGTGCAGGCATCAAGCGGATGCGGGCTCAGCTCCCTCATGTCAA AGTCCACGCCTACTTTGCTCCCGTCACCCCACCGACAGCAGTGGCAGGAAGTGGACAGCGACTGTGCAGG TGCTGTGTCATTCTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001171713 |
ORF Size | 1068 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001171713.1, NP_001165184.1 |
RefSeq Size | 2793 |
RefSeq ORF | 1068 |
Locus ID | 25827 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains 12 tandem leucine-rich repeats. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010] Transcript Variant: This variant (2) encodes isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229929 | FBXL2 (Myc-DDK-tagged)-Human F-box and leucine-rich repeat protein 2 (FBXL2), transcript variant 2 |
USD 420.00 |
|
RG229929 | FBXL2 (GFP-tagged) - Human F-box and leucine-rich repeat protein 2 (FBXL2), transcript variant 2 |
USD 460.00 |
|
RC229929L1 | Lenti ORF clone of Human F-box and leucine-rich repeat protein 2 (FBXL2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC229929L2 | Lenti ORF clone of Human F-box and leucine-rich repeat protein 2 (FBXL2), transcript variant 2, mGFP tagged |
USD 768.00 |
|
RC229929L3 | Lenti ORF clone of Human F-box and leucine-rich repeat protein 2 (FBXL2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC229929L4 | Lenti ORF clone of Human F-box and leucine-rich repeat protein 2 (FBXL2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review