PGM1 (NM_001172819) Human Untagged Clone

CAT#: SC328587

PGM1 (untagged)-Human phosphoglucomutase 1 (PGM1) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PGM1
• Synonyms: CDG1T; GSD14
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001172819, the custom clone sequence may differ by one or more nucleotides
  ATGCTGAGAAGCATCTTTGATTTCAGTGCACTGAAAGAACTACTTTCTGGGCCAAACCGA
  CTGAAGATCCGTATTGATGCTATGCATGGAGTTGTGGGACCGTATGTAAAGAAGATCCTC
  TGTGAAGAACTCGGTGCCCCTGCGAACTCGGCAGTTAACTGCGTTCCTCTGGAGGACTTT
  GGAGGCCACCACCCTGACCCCAACCTCACCTATGCAGCTGACCTGGTGGAGACCATGAAG
  TCAGGAGAGCATGATTTTGGGGCTGCCTTTGATGGAGATGGGGATCGAAACATGATTCTG
  GGCAAGCATGGGTTCTTTGTGAACCCTTCAGACTCTGTGGCTGTCATTGCTGCCAACATC
  TTCAGCATTCCGTATTTCCAGCAGACTGGGGTCCGCGGCTTTGCACGGAGCATGCCCACG
  AGTGGTGCTCTGGACCGGGTGGCTAGTGCTACAAAGATTGCTTTGTATGAGACCCCAACT
  GGCTGGAAGTTTTTTGGGAATTTGATGGACGCGAGCAAACTGTCCCTTTGTGGGGAGGAG
  AGCTTCGGGACCGGTTCTGACCACATCCGTGAGAAAGATGGACTGTGGGCTGTCCTTGCC
  TGGCTCTCCATCCTAGCCACCCGCAAGCAGAGTGTGGAGGACATTCTCAAAGATCATTGG
  CAAAAGTATGGCCGGAATTTCTTCACCAGGTATGATTACGAGGAGGTGGAAGCTGAGGGC
  GCAAACAAAATGATGAAGGACTTGGAGGCCCTGATGTTTGATCGCTCCTTTGTGGGGAAG
  CAGTTCTCAGCAAATGACAAAGTTTACACTGTGGAGAAGGCCGATAACTTTGAATACAGC
  GACCCAGTGGATGGAAGCATTTCAAGAAATCAGGGCTTGCGCCTCATTTTCACAGATGGT
  TCTCGAATCGTCTTCCGACTGAGCGGCACTGGGAGTGCCGGGGCCACCATTCGGCTGTAC
  ATCGATAGCTATGAGAAGGACGTTGCCAAGATTAACCAGGACCCCCAGGTCATGTTGGCC
  CCCCTTATTTCCATTGCTCTGAAAGTGTCCCAGCTGCAGGAGAGGACGGGACGCACTGCA
  CCCACTGTCATCACCTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001172819
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001172819.1, NP_001166290.1
• RefSeq Size: 2364 bp
• RefSeq ORF: 1098 bp
• Locus ID: 5236
• Cytogenetics: 1p31.3
• Protein Pathways: Amino sugar and nucleotide sugar metabolism, Galactose metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways, Pentose phosphate pathway, Starch and sucrose metabolism
• Gene Summary: 'The protein encoded by this gene is an isozyme of phosphoglucomutase (PGM) and belongs to the phosphohexose mutase family. There are several PGM isozymes, which are encoded by different genes and catalyze the transfer of phosphate between the 1 and 6 positions of glucose. In most cell types, this PGM isozyme is predominant, representing about 90% of total PGM activity. In red cells, PGM2 is a major isozyme. This gene is highly polymorphic. Mutations in this gene cause glycogen storage disease type 14. Alternativley spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Mar 2010]'
  Transcript Variant: This variant (3) has an alternate 5' exon, which results in a downstream AUG start codon, as compared to variant 1. The resulting isoform (3) is shorter at the N-terminus, as compared to isoform 1.