CD244 (NM_001166663) Human Untagged Clone

CAT#: SC328592

CD244 (untagged)-Human CD244 molecule natural killer cell receptor 2B4 (CD244) transcript variant 2


  "NM_001166663" in other vectors (4)

Reconstitution Protocol

USD 640.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CD244"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CD244
Synonyms 2B4; NAIL; NKR2B4; Nmrk; SLAMF4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001166663, the custom clone sequence may differ by one or more nucleotides


ATGCTGGGGCAAGTGGTCACCCTCATACTCCTCCTGCTCCTCAAGGTGTATCAGGGCAAAGGATGCCAGG
GATCAGCTGACCATGTGGTTAGCATCTCGGGAGTGCCTCTTCAGTTACAACCAAACAGCATACAGACGAA
GGTTGACAGCATTGCATGGAAGAAGTTGCTGCCCTCACAAAATGGATTTCATCACATATTGAAGTGGGAG
AATGGCTCTTTGCCTTCCAATACTTCCAATGATAGATTCAGTTTTATAGTCAAGAACTTGAGTCTTCTCA
TCAAGGCAGCTCAGCAGCAGGACAGTGGCCTCTACTGCCTGGAGGTCACCAGTATATCTGGAAAAGTTCA
GACAGCCACGTTCCAGGTTTTTGTATTTGAATCTCTGCTTCCAGATAAAGTTGAGAAACCCCGCCTACAG
GGGCAGGGGAAGATCCTGGACAGAGGGAGATGCCAAGTGGCTCTGTCTTGCTTGGTCTCCAGGGATGGCA
ATGTGTCCTATGCTTGGTACAGAGGGAGCAAGCTGATCCAGACAGCAGGGAACCTCACCTACCTGGACGA
GGAGGTTGACATTAATGGCACTCACACATATACCTGCAATGTCAGCAATCCTGTTAGCTGGGAAAGCCAC
ACCCTGAATCTCACTCAGGACTGTCAGAATGCCCATCAGGAATTCAGATTTTGGCCGTTTTTGGTGATCA
TCGTGATTCTAAGCGCACTGTTCCTTGGCACCCTTGCCTGCTTCTGTGTGTGGAGGAGAAAGAGGAAGGA
GAAGCAGTCAGAGACCAGTCCCAAGGAATTTTTGACAATTTACGAAGATGTCAAGGATCTGAAAACCAGG
AGAAATCACGAGCAGGAGCAGACTTTTCCTGGAGGGGGGAGCACCATCTACTCTATGATCCAGTCCCAGT
CTTCTGCTCCCACGTCACAAGAACCTGCATATACATTATATTCATTAATTCAGCCTTCCAGGAAGTCTGG
ATCCAGGAAGAGGAACCACAGCCCTTCCTTCAATAGCACTATCTATGAAGTGATTGGAAAGAGTCAACCT
AAAGCCCAGAACCCTGCTCGATTGAGCCGCAAAGAGCTGGAGAACTTTGATGTTTATTCCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001166663
ORF Size 1113 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001166663.1, NP_001160135.1
RefSeq Size 2543
RefSeq ORF 1113
Locus ID 51744
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transmembrane
Protein Pathways Natural killer cell mediated cytotoxicity
Gene Summary This gene encodes a cell surface receptor expressed on natural killer (NK) cells (and some T cells) that mediate non-major histocompatibility complex (MHC) restricted killing. The interaction between NK-cell and target cells via this receptor is thought to modulate NK-cell cytolytic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (2) uses an alternate acceptor splice site at one of the coding exons compared to variant 1, resulting in an isoform (2) that is 5 aa longer than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.