CD244 (NM_001166663) Human Untagged Clone
CAT#: SC328592
CD244 (untagged)-Human CD244 molecule natural killer cell receptor 2B4 (CD244) transcript variant 2
"NM_001166663" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CD244 |
Synonyms | 2B4; NAIL; NKR2B4; Nmrk; SLAMF4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001166663, the custom clone sequence may differ by one or more nucleotides
ATGCTGGGGCAAGTGGTCACCCTCATACTCCTCCTGCTCCTCAAGGTGTATCAGGGCAAAGGATGCCAGG GATCAGCTGACCATGTGGTTAGCATCTCGGGAGTGCCTCTTCAGTTACAACCAAACAGCATACAGACGAA GGTTGACAGCATTGCATGGAAGAAGTTGCTGCCCTCACAAAATGGATTTCATCACATATTGAAGTGGGAG AATGGCTCTTTGCCTTCCAATACTTCCAATGATAGATTCAGTTTTATAGTCAAGAACTTGAGTCTTCTCA TCAAGGCAGCTCAGCAGCAGGACAGTGGCCTCTACTGCCTGGAGGTCACCAGTATATCTGGAAAAGTTCA GACAGCCACGTTCCAGGTTTTTGTATTTGAATCTCTGCTTCCAGATAAAGTTGAGAAACCCCGCCTACAG GGGCAGGGGAAGATCCTGGACAGAGGGAGATGCCAAGTGGCTCTGTCTTGCTTGGTCTCCAGGGATGGCA ATGTGTCCTATGCTTGGTACAGAGGGAGCAAGCTGATCCAGACAGCAGGGAACCTCACCTACCTGGACGA GGAGGTTGACATTAATGGCACTCACACATATACCTGCAATGTCAGCAATCCTGTTAGCTGGGAAAGCCAC ACCCTGAATCTCACTCAGGACTGTCAGAATGCCCATCAGGAATTCAGATTTTGGCCGTTTTTGGTGATCA TCGTGATTCTAAGCGCACTGTTCCTTGGCACCCTTGCCTGCTTCTGTGTGTGGAGGAGAAAGAGGAAGGA GAAGCAGTCAGAGACCAGTCCCAAGGAATTTTTGACAATTTACGAAGATGTCAAGGATCTGAAAACCAGG AGAAATCACGAGCAGGAGCAGACTTTTCCTGGAGGGGGGAGCACCATCTACTCTATGATCCAGTCCCAGT CTTCTGCTCCCACGTCACAAGAACCTGCATATACATTATATTCATTAATTCAGCCTTCCAGGAAGTCTGG ATCCAGGAAGAGGAACCACAGCCCTTCCTTCAATAGCACTATCTATGAAGTGATTGGAAAGAGTCAACCT AAAGCCCAGAACCCTGCTCGATTGAGCCGCAAAGAGCTGGAGAACTTTGATGTTTATTCCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001166663 |
ORF Size | 1113 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001166663.1, NP_001160135.1 |
RefSeq Size | 2543 |
RefSeq ORF | 1113 |
Locus ID | 51744 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Transmembrane |
Protein Pathways | Natural killer cell mediated cytotoxicity |
Gene Summary | This gene encodes a cell surface receptor expressed on natural killer (NK) cells (and some T cells) that mediate non-major histocompatibility complex (MHC) restricted killing. The interaction between NK-cell and target cells via this receptor is thought to modulate NK-cell cytolytic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009] Transcript Variant: This variant (2) uses an alternate acceptor splice site at one of the coding exons compared to variant 1, resulting in an isoform (2) that is 5 aa longer than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229954 | CD244 (Myc-DDK-tagged)-Human CD244 molecule, natural killer cell receptor 2B4 (CD244), transcript variant 2 |
USD 98.00 |
|
RG229954 | CD244 (GFP-tagged) - Human CD244 molecule, natural killer cell receptor 2B4 (CD244), transcript variant 2 |
USD 460.00 |
|
RC229954L3 | Lenti ORF clone of Human CD244 molecule, natural killer cell receptor 2B4 (CD244), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC229954L4 | Lenti ORF clone of Human CD244 molecule, natural killer cell receptor 2B4 (CD244), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review