ZIC4 (NM_001168379) Human Untagged Clone

CAT#: SC328593

ZIC4 (untagged)-Human Zic family member 4 (ZIC4) transcript variant 2


  "NM_001168379" in other vectors (4)

Reconstitution Protocol

USD 640.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ZIC4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZIC4
Synonyms FLJ42609; FLJ45833
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001168379, the custom clone sequence may differ by one or more nucleotides


ATGAATGGCCCATGTCAAAGTCTTAGGAAAGCGGAGGGGCTTTTGGAGGGTTGCACTTCGGCCGTCACCG
TCTTCAGGAAACTCCCTTTGGATTCCAAGGCTCAAAGTCAGAAAATGAGATACAAGACATCCTTGGTGAT
GAGGAAACGATTACGGCTTTACCGAAACACTCTTAAAGAGTCAAGTAGCAGCTCTGGACACCATGGCCCC
CAGCTCACCGCCGCCTCCAGCCCCTCGGTGTTCCCGGGCCTCCACGAGGAGCCTCCCCAGGCCTCCCCCA
GCCGTCCTTTGAATGGACTCCTGCGTCTGGGGCTCCCTGGAGACATGTACGCGCGGCCGGAGCCCTTCCC
GCCAGGGCCTGCGGCCCGCAGCGACGCCCTGGCAGCTGCCGCAGCCCTGCATGGCTACGGGGGCATGAAC
CTGACGGTGAACCTCGCTGCGCCCCACGGTCCTGGCGCTTTCTTCCGCTACATGCGCCAGCCCATCAAAC
AGGAGCTCATCTGCAAGTGGCTGGCGGCCGACGGCACCGCGACCCCGAGCCTCTGCTCCAAAACTTTCAG
CACCATGCACGAGCTGGTCACGCACGTCACCGTGGAGCACGTCGGCGGCCCGGAACAGGCCAACCACATT
TGCTTCTGGGAGGAGTGTCCGCGCCAGGGAAAGCCCTTCAAAGCCAAATACAAACTTGTAAATCACATCC
GCGTGCACACGGGCGAGAAGCCCTTCCCTTGTCCTTTCCCGGGGTGTGGGAAGGTCTTTGCTAGATCAGA
AAATCTCAAAATACACAAACGAACTCACACAGGCGAGAAGCCCTTCAGATGCGAGTTCGAGGGCTGCGAG
CGGCGCTTCGCCAACAGCAGCGACCGTAAGAAGCATTCGCACGTGCACACTAGCGACAAGCCATACACGT
GCAAGGTGCGGGGCTGCGACAAGTGCTACACGCACCCCAGCTCGCTGCGTAAGCACATGAAGGTGCACGG
GCGCTCGCCGCCGCCCAGCTCTGGCTACGATTCGGCTACACCGTCTGCCCTCGTGTCGCCCTCGTCGGAC
TGCGGCCACAAGTCCCAGGTGGCCTCCTCGGCGGCGGTGGCGGCGCGTACCGCCGACTTGAGCGAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001168379
ORF Size 1119 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001168379.1, NP_001161851.1
RefSeq Size 3979
RefSeq ORF 1119
Locus ID 84107
Gene Summary This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development, and have been associated with X-linked visceral heterotaxy and holoprosencephaly type 5. This gene is closely linked to the gene encoding zinc finger protein of the cerebellum 1, a related family member on chromosome 3. Heterozygous deletion of these linked genes is involved in Dandy-Walker malformation, which is a congenital cerebellar malformation. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Dec 2009]
Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region, compared to variant 1, resulting in an isoform (2) with a distinct and shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.