PHKG2 (NM_001172432) Human Untagged Clone

CAT#: SC328597

PHKG2 (untagged)-Human phosphorylase kinase gamma 2 (testis) (PHKG2) transcript variant 2


  "NM_001172432" in other vectors (4)

Reconstitution Protocol

USD 640.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PHKG2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PHKG2
Synonyms GSD9C
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001172432, the custom clone sequence may differ by one or more nucleotides


ATGACGCTGGACGTGGGGCCGGAGGATGAGCTGCCCGACTGGGCCGCCGCCAAAGAGTTTTACCAGAAGT
ACGACCCTAAGGACGTCATCGGCAGAGGAGTGAGCTCTGTGGTCCGCCGTTGTGTTCATCGAGCTACTGG
CCACGAGTTTGCGGTGAAGATTATGGAAGTGACAGCTGAGCGGCTGAGTCCTGAGCAGCTGGAGGAGGTG
CGGGAAGCCACACGGCGAGAGACACACATCCTTCGCCAGGTCGCCGGCCACCCCCACATCATCACCCTCA
TCGATTCCTACGAGTCTTCTAGCTTCATGTTCCTGGTGTTTGACCTGATGCGGAAGGGAGAGCTGTTTGA
CTATCTCACAGAGAAGGTGGCCCTCTCTGAAAAGGAAACCAGGTCCATCATGCGGTCTCTGCTGGAAGCA
GTGAGCTTTCTCCATGCCAACAACATTGTGCATCGAGATCTGAAGCCCGAGAATATTCTCCTAGATGACA
ATATGCAGATCCGACTTTCAGATTTCGGGTTCTCCTGCCACTTGGAACCTGGCGAGAAGCTTCGAGAGTT
GTGTGGGACCCCAGGGTATCTAGCGCCAGAGATCCTTAAATGCTCCATGGATGAAACCCACCCAGGCTAT
GGCAAGGAGGTCGACCTCTGGGCCTGTGGGGTGATCTTGTTCACACTCCTGGCTGGCTCGCCACCCTTCT
GGCACCGGCGGCAGATCCTGATGTTACGCATGATCATGGAGGGCCAGTACCAGTTCAGTTCCCCCGAGTG
GGATGACCGTTCCAGCACTGTCAAAGACCTGATCTCCAGGCTGCTGCAGGTGGATCCTGAGGCACGCCTG
ACAGCTGAGCAGGCCCTACAGCACCCCTTCTTTGAGCGTTGTGAAGGCAGCCAACCCTGGAACCTCACCC
CCCGCCAGCGGTTCCGGGTGGCAGTGTGGACAGTGCTGGCTGCTGGACGAGTGGCCCTAAGCACCCATCG
TGTACGGCCACTGACCAAGAATGCACTGTTGAGGGACCCTTATGCGCTGCGGTCAGTGCGGCACCTCATC
GACAACTGTGCCTTCCGGCTCTACGGGCACTGGATAAGGAAGCAGTGGATTGGAAAGCTGATGGCTTGTG
TATGA


Restriction Sites SgfI-MluI     
ACCN NM_001172432
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001172432.1, NP_001165903.1
RefSeq Size 2367 bp
RefSeq ORF 1125 bp
Locus ID 5261
Cytogenetics 16p11.2
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Calcium signaling pathway, Insulin signaling pathway
Gene Summary 'Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, and the hepatic isoform is encoded by this gene. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9C, also known as autosomal liver glycogenosis. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]'
Transcript Variant: This variant (2) lacks an internal segment in the 3' region, as compared to variant 1. The resulting isoform (2) is shorter and has a different C-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.