CD14 (NM_001174104) Human Untagged Clone
CAT#: SC328600
CD14 (untagged)-Human CD14 molecule (CD14) transcript variant 3
"NM_001174104" in other vectors (4)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CD14 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001174104, the custom clone sequence may differ by one or more nucleotides
ATGGAGCGCGCGTCCTGCTTGTTGCTGCTGCTGCTGCCGCTGGTGCACGTCTCTGCGACC ACGCCAGAACCTTGTGAGCTGGACGATGAAGATTTCCGCTGCGTCTGCAACTTCTCCGAA CCTCAGCCCGACTGGTCCGAAGCCTTCCAGTGTGTGTCTGCAGTAGAGGTGGAGATCCAT GCCGGCGGTCTCAACCTAGAGCCGTTTCTAAAGCGCGTCGATGCGGACGCCGACCCGCGG CAGTATGCTGACACGGTCAAGGCTCTCCGCGTGCGGCGGCTCACAGTGGGAGCCGCACAG GTTCCTGCTCAGCTACTGGTAGGCGCCCTGCGTGTGCTAGCGTACTCCCGCCTCAAGGAA CTGACGCTCGAGGACCTAAAGATAACCGGCACCATGCCTCCGCTGCCTCTGGAAGCCACA GGACTTGCACTTTCCAGCTTGCGCCTACGCAACGTGTCGTGGGCGACAGGGCGTTCTTGG CTCGCCGAGCTGCAGCAGTGGCTCAAGCCAGGCCTCAAGGTACTGAGCATTGCCCAAGCA CACTCGCCTGCCTTTTCCTGCGAACAGGTTCGCGCCTTCCCGGCCCTTACCAGCCTAGAC CTGTCTGACAATCCTGGACTGGGCGAACGCGGACTGATGGCGGCTCTCTGTCCCCACAAG TTCCCGGCCATCCAGAATCTAGCGCTGCGCAACACAGGAATGGAGACGCCCACAGGCGTG TGCGCCGCACTGGCGGCGGCAGGTGTGCAGCCCCACAGCCTAGACCTCAGCCACAACTCG CTGCGCGCCACCGTAAACCCTAGCGCTCCGAGATGCATGTGGTCCAGCGCCCTGAACTCC CTCAATCTGTCGTTCGCTGGGCTGGAACAGGTGCCTAAAGGACTGCCAGCCAAGCTCAGA GTGCTCGATCTCAGCTGCAACAGACTGAACAGGGCGCCGCAGCCTGACGAGCTGCCCGAG GTGGATAACCTGACACTGGACGGGAATCCCTTCCTGGTCCCTGGAACTGCCCTCCCCCAC GAGGGCTCAATGAACTCCGGCGTGGTCCCAGCCTGTGCACGTTCGACCCTGTCGGTGGGG GTGTCGGGAACCCTGGTGCTGCTCCAAGGGGCCCGGGGCTTTGCCTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001174104 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001174104.1, NP_001167575.1 |
| RefSeq Size | 1661 bp |
| RefSeq ORF | 1128 bp |
| Locus ID | 929 |
| Cytogenetics | 5q31.3 |
| Protein Families | Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Transmembrane |
| Protein Pathways | Hematopoietic cell lineage, MAPK signaling pathway, Pathogenic Escherichia coli infection, Regulation of actin cytoskeleton, Toll-like receptor signaling pathway |
| Gene Summary | 'The protein encoded by this gene is a surface antigen that is preferentially expressed on monocytes/macrophages. It cooperates with other proteins to mediate the innate immune response to bacterial lipopolysaccharide, and to viruses. This gene has been identified as a target candidate in the treatment of SARS-CoV-2-infected patients to potentially lessen or inhibit a severe inflammatory response. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Aug 2020]' Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1-4 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229962 | CD14 (Myc-DDK-tagged)-Human CD14 molecule (CD14), transcript variant 3 |
USD 420.00 |
|
| RG229962 | CD14 (GFP-tagged) - Human CD14 molecule (CD14), transcript variant 3 |
USD 460.00 |
|
| RC229962L3 | Lenti-ORF clone of CD14 (Myc-DDK-tagged)-Human CD14 molecule (CD14), transcript variant 3 |
USD 620.00 |
|
| RC229962L4 | Lenti-ORF clone of CD14 (mGFP-tagged)-Human CD14 molecule (CD14), transcript variant 3 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China