TAZ (WWTR1) (NM_001168278) Human Untagged Clone

CAT#: SC328639

WWTR1 (untagged)-Human WW domain containing transcription regulator 1 (WWTR1) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: WWTR1
• Synonyms: TAZ
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001168278, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAATCCGGCCTCGGCGCCCCCTCCGCTCCCGCCGCCTGGGCAGCAAGTGATCCACGTCACGCAGGACC
  TAGACACAGACCTCGAAGCCCTCTTCAACTCTGTCATGAATCCGAAGCCTAGCTCGTGGCGGAAGAAGAT
  CCTGCCGGAGTCTTTCTTTAAGGAGCCTGATTCGGGCTCGCACTCGCGCCAGTCCAGCACCGACTCGTCG
  GGCGGCCACCCGGGGCCTCGACTGGCTGGGGGTGCCCAGCATGTCCGCTCGCACTCGTCGCCCGCGTCCC
  TGCAGCTGGGCACCGGCGCGGGTGCTGCGGGTAGCCCCGCGCAGCAGCACGCGCACCTCCGCCAGCAGTC
  CTACGACGTGACCGACGAGCTGCCACTGCCCCCGGGCTGGGAGATGACCTTCACGGCCACTGGCCAGAGG
  TACTTCCTCAATCACATAGAAAAAATCACCACATGGCAAGACCCTAGGAAGGCGATGAATCAGCCTCTGA
  ATCATATGAACCTCCACCCTGCCGTCAGTTCCACACCAGTGCCTCAGAGGTCCATGGCAGTATCCCAGCC
  AAATCTCGTGATGAATCACCAACACCAGCAGCAGATGGCCCCCAGTACCCTGAGCCAGCAGAACCACCCC
  ACTCAGAACCCACCCGCAGGGCTCATGAGTATGCCCAATGCGCTGACCACTCAGCAGCAGCAGCAGCAGA
  AACTGCGGCTTCAGAGAATCCAGATGGAGAGAGAAAGGATTCGAATGCGCCAAGAGGAGCTCATGAGGCA
  GGAAGCTGCCCTCTGTCGACAGCTCCCCATGGAAGCTGAGACTCTTGCCCCAGTTCAGGCTGCTGTCAAC
  CCACCCACGATGACCCCAGACATGAGATCCATCACTAATAATAGCTCAGATCCTTTCCTCAATGGAGGGC
  CATATCATTCGAGGGAGCAGAGCACTGACAGTGGCCTGGGGTTAGGGTGCTACAGTGTCCCCACAACTCC
  GGAGGACTTCCTCAGCAATGTGGATGAGATGGATACAGGAGAAAACGCAGGACAAACACCCATGAACATC
  AATCCCCAACAGACCCGTTTCCCTGATTTCCTTGACTGTCTTCCAGGAACAAACGTTGACTTAGGAACTT
  TGGAATCTGAAGACCTGATCCCCCTCTTCAATGATGTAGAGTCTGCTCTGAACAAAAGTGAGCCCTTTCT
  AACCTGGCTGTAA
  
  
• Restriction Sites: Please inquire
• ACCN: NM_001168278
• ORF Size: 1203 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001168278.1, NP_001161750.1
• RefSeq Size: 5052
• RefSeq ORF: 1203
• Locus ID: 25937
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: Transcriptional coactivator which acts as a downstream regulatory target in the Hippo signaling pathway that plays a pivotal role in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein STK3/MST2 and STK4/MST1, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ. WWTR1 enhances PAX8 and NKX2-1/TTF1-dependent gene activation. Regulates the nuclear accumulation of SMADS and has a key role in coupling them to the transcriptional machinery such as the mediator complex. Regulates embryonic stem-cell self-renewal, promotes cell proliferation and epithelial-mesenchymal transition. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 4. Variants 1 through 4 all encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.