Fibrinogen beta chain (FGB) (NM_001184741) Human Untagged Clone

CAT#: SC328711

FGB (untagged)-Human fibrinogen beta chain (FGB) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FGB
• Synonyms: HEL-S-78p
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001184741, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAAAGGATGGTTTCTTGGAGCTTCCACAAACTTAAAACCATGAAACATCTATTATTGCTACTATTGT
  GTGTTTTTCTAGTTAAGTCCCAAGGTGTCAACGACAATGAGGAGGGTTTCTTCAGTGCCCGTGGTCATCG
  ACCCCTTGACAAGAAGAGAGAAGAGGCTTTGCTACAACAGGAAAGGCCAATCAGAAATAGTGTTGATGAG
  TTAAATAACAATGTGGAAGCTGTTTCCCAGACCTCCTCTTCTTCCTTTCAGTACATGTATTTGCTGAAAG
  ACCTGTGGCAAAAGAGGCAGAAGCAAGTAAAAGATAATGAAAATGTAGTCAATGAGTACTCCTCAGAACT
  GGAAAAGCACCAATTATATATAGATGAGACTGTGAATAGCAATATCCCAACTAACCTTCGTGTGCTTCGT
  TCAATCCTGGAAAACCTGAGAAGCAAAATACAAAAGTTAGAATCTGATGTCTCAGCTCAAATGGAATATT
  GTCGCACCCCATGCACTGTCAGTTGCAATATTCCTGTGGTGTCTGGCAAAGAATGTGAGGAAATTATCAG
  GAAAGGAGGTGAAACATCTGAAATGTATCTCATTCAACCTGACAGTTCTGTCAAACCGTATAGAGTATAC
  TGTGACATGAATACAGAAAATGGAGGATGGACAGTGATTCAGAACCGTCAAGACGGTAGTGTTGACTTTG
  GCAGGAAATGGGATCCATATAAACAGGGATTTGGAAATGTTGCAACCAACACAGATGGGAAGAATTACTG
  TGGCCTACCAGGTGAATATTGGCTTGGAAATGATAAAATTAGCCAGCTTACCAGGATGGGACCCACAGAA
  CTTTTGATAGAAATGGAGGACTGGAAAGGAGACAAAGTAAAGGCTCACTATGGAGGATTCACTGTACAGA
  ATGAAGCCAACAAATACCAGATCTCAGTGAACAAATACAGAGGAACAGCCGGTAATGCCCTCATGGATGG
  AGCATCTCAGCTGATGGGAGAAAACAGGACCATGACCATTCACAACGGCATGTTCTTCAGCACGTATGAC
  AGAGACAATGACGGCTGGTTAACATCAGATCCCAGAAAACAGTGTTCTAAAGAAGACGGTGGTGGATGGT
  GGTATAATAGATGTCATGCAGCCAATCCAAACGGCAGATACTACTGGGGTGGACAGTACACCTGGGACAT
  GGCAAAGCATGGCACAGATGATGGTGTAGTATGGATGAATTGGAAGGGGTCATGGTACTCAATGAGGAAG
  ATGAGTATGAAGATCAGGCCCTTCTTCCCACAGCAATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001184741
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001184741.1, NP_001171670.1
• RefSeq Size: 3451 bp
• RefSeq ORF: 1299 bp
• Locus ID: 2244
• Cytogenetics: 4q31.3
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Complement and coagulation cascades
• Gene Summary: 'The protein encoded by this gene is the beta component of fibrinogen, a blood-borne glycoprotein comprised of three pairs of nonidentical polypeptide chains. Following vascular injury, fibrinogen is cleaved by thrombin to form fibrin which is the most abundant component of blood clots. In addition, various cleavage products of fibrinogen and fibrin regulate cell adhesion and spreading, display vasoconstrictor and chemotactic activities, and are mitogens for several cell types. Fibrinogen serves key roles in hemostasis and antimicrobial host defense. Mutations in this gene lead to several disorders, including afibrinogenemia, dysfibrinogenemia, hypodysfibrinogenemia and thrombotic tendency. [provided by RefSeq, Aug 2020]'
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.