Alkaline Phosphatase (ALPL) (NM_001177520) Human Untagged Clone

CAT#: SC328739

ALPL (untagged)-Human alkaline phosphatase liver/bone/kidney (ALPL) transcript variant 3


  "NM_001177520" in other vectors (4)

Reconstitution Protocol

USD 750.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ALPL"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ALPL
Synonyms AP-TNAP; APTNAP; HOPS; TNALP; TNAP; TNSALP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001177520, the custom clone sequence may differ by one or more nucleotides


ATGCCCTGGAGCTTCAGAAGCTCAACACCAACGTGGCTAAGAATGTCATCATGTTCCTGGGAGATGACGT
ACAACACCAATGCCCAGGTCCCTGACAGCGCCGGCACCGCCACCGCCTACCTGTGTGGGGTGAAGGCCAA
TGAGGGCACCGTGGGGGTAAGCGCAGCCACTGAGCGTTCCCGGTGCAACACCACCCAGGGGAACGAGGTC
ACCTCCATCCTGCGCTGGGCCAAGGACGCTGGGAAATCTGTGGGCATTGTGACCACCACGAGAGTGAACC
ATGCCACCCCCAGCGCCGCCTACGCCCACTCGGCTGACCGGGACTGGTACTCAGACAACGAGATGCCCCC
TGAGGCCTTGAGCCAGGGCTGTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTG
ATCATGGGGGGTGGCCGGAAATACATGTACCCCAAGAATAAAACTGATGTGGAGTATGAGAGTGACGAGA
AAGCCAGGGGCACGAGGCTGGACGGCCTGGACCTCGTTGACACCTGGAAGAGCTTCAAACCGAGATACAA
GCACTCCCACTTCATCTGGAACCGCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTG
GGTCTCTTCGAGCCAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGACCCGTCACTCTCCG
AGATGGTGGTGGTGGCCATCCAGATCCTGCGGAAGAACCCCAAAGGCTTCTTCTTGCTGGTGGAAGGAGG
CAGAATTGACCACGGGCACCATGAAGGAAAAGCCAAGCAGGCCCTGCATGAGGCGGTGGAGATGGACCGG
GCCATCGGGCAGGCAGGCAGCTTGACCTCCTCGGAAGACACTCTGACCGTGGTCACTGCGGACCATTCCC
ACGTCTTCACATTTGGTGGATACACCCCCCGTGGCAACTCTATCTTTGGTCTGGCCCCCATGCTGAGTGA
CACAGACAAGAAGCCCTTCACTGCCATCCTGTATGGCAATGGGCCTGGCTACAAGGTGGTGGGCGGTGAA
CGAGAGAATGTCTCCATGGTGGACTATGCTCACAACAACTACCAGGCGCAGTCTGCTGTGCCCCTGCGCC
ACGAGACCCACGGCGGGGAGGACGTGGCCGTCTTCTCCAAGGGCCCCATGGCGCACCTGCTGCACGGCGT
CCACGAGCAGAACTACGTCCCCCACGTGATGGCGTATGCAGCCTGCATCGGGGCCAACCTCGGCCACTGT
GCTCCTGCCAGCTCGGCAGGCAGCCTTGCTGCAGGCCCCCTGCTGCTCGCGCTGGCCCTCTACCCCCTGA
GCGTCCTGTTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001177520
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001177520.2, NP_001170991.1
RefSeq Size 2332 bp
RefSeq ORF 1344 bp
Locus ID 249
Cytogenetics 1p36.12
Protein Families Druggable Genome
Protein Pathways Folate biosynthesis, Metabolic pathways
Gene Summary 'This gene encodes a member of the alkaline phosphatase family of proteins. There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The first three are located together on chromosome 2, while the tissue non-specific form is located on chromosome 1. The product of this gene is a membrane bound glycosylated enzyme that is not expressed in any particular tissue and is, therefore, referred to as the tissue-nonspecific form of the enzyme. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature enzyme. This enzyme may play a role in bone mineralization. Mutations in this gene have been linked to hypophosphatasia, a disorder that is characterized by hypercalcemia and skeletal defects. [provided by RefSeq, Oct 2015]'
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. This variant also lacks an exon in the 5' coding region, compared to variant 1. The encoded isoform (3) has a distinct N-terminus, lacks a predicted signal peptide, and is shorter compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.