Alkaline Phosphatase (ALPL) (NM_001177520) Human Untagged Clone
CAT#: SC328739
ALPL (untagged)-Human alkaline phosphatase liver/bone/kidney (ALPL) transcript variant 3
"NM_001177520" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ALPL |
Synonyms | AP-TNAP; APTNAP; HOPS; TNALP; TNAP; TNSALP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001177520, the custom clone sequence may differ by one or more nucleotides
ATGCCCTGGAGCTTCAGAAGCTCAACACCAACGTGGCTAAGAATGTCATCATGTTCCTGGGAGATGACGT ACAACACCAATGCCCAGGTCCCTGACAGCGCCGGCACCGCCACCGCCTACCTGTGTGGGGTGAAGGCCAA TGAGGGCACCGTGGGGGTAAGCGCAGCCACTGAGCGTTCCCGGTGCAACACCACCCAGGGGAACGAGGTC ACCTCCATCCTGCGCTGGGCCAAGGACGCTGGGAAATCTGTGGGCATTGTGACCACCACGAGAGTGAACC ATGCCACCCCCAGCGCCGCCTACGCCCACTCGGCTGACCGGGACTGGTACTCAGACAACGAGATGCCCCC TGAGGCCTTGAGCCAGGGCTGTAAGGACATCGCCTACCAGCTCATGCATAACATCAGGGACATTGACGTG ATCATGGGGGGTGGCCGGAAATACATGTACCCCAAGAATAAAACTGATGTGGAGTATGAGAGTGACGAGA AAGCCAGGGGCACGAGGCTGGACGGCCTGGACCTCGTTGACACCTGGAAGAGCTTCAAACCGAGATACAA GCACTCCCACTTCATCTGGAACCGCACGGAACTCCTGACCCTTGACCCCCACAATGTGGACTACCTATTG GGTCTCTTCGAGCCAGGGGACATGCAGTACGAGCTGAACAGGAACAACGTGACGGACCCGTCACTCTCCG AGATGGTGGTGGTGGCCATCCAGATCCTGCGGAAGAACCCCAAAGGCTTCTTCTTGCTGGTGGAAGGAGG CAGAATTGACCACGGGCACCATGAAGGAAAAGCCAAGCAGGCCCTGCATGAGGCGGTGGAGATGGACCGG GCCATCGGGCAGGCAGGCAGCTTGACCTCCTCGGAAGACACTCTGACCGTGGTCACTGCGGACCATTCCC ACGTCTTCACATTTGGTGGATACACCCCCCGTGGCAACTCTATCTTTGGTCTGGCCCCCATGCTGAGTGA CACAGACAAGAAGCCCTTCACTGCCATCCTGTATGGCAATGGGCCTGGCTACAAGGTGGTGGGCGGTGAA CGAGAGAATGTCTCCATGGTGGACTATGCTCACAACAACTACCAGGCGCAGTCTGCTGTGCCCCTGCGCC ACGAGACCCACGGCGGGGAGGACGTGGCCGTCTTCTCCAAGGGCCCCATGGCGCACCTGCTGCACGGCGT CCACGAGCAGAACTACGTCCCCCACGTGATGGCGTATGCAGCCTGCATCGGGGCCAACCTCGGCCACTGT GCTCCTGCCAGCTCGGCAGGCAGCCTTGCTGCAGGCCCCCTGCTGCTCGCGCTGGCCCTCTACCCCCTGA GCGTCCTGTTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001177520 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001177520.2, NP_001170991.1 |
RefSeq Size | 2332 bp |
RefSeq ORF | 1344 bp |
Locus ID | 249 |
Cytogenetics | 1p36.12 |
Protein Families | Druggable Genome |
Protein Pathways | Folate biosynthesis, Metabolic pathways |
Gene Summary | 'This gene encodes a member of the alkaline phosphatase family of proteins. There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The first three are located together on chromosome 2, while the tissue non-specific form is located on chromosome 1. The product of this gene is a membrane bound glycosylated enzyme that is not expressed in any particular tissue and is, therefore, referred to as the tissue-nonspecific form of the enzyme. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature enzyme. This enzyme may play a role in bone mineralization. Mutations in this gene have been linked to hypophosphatasia, a disorder that is characterized by hypercalcemia and skeletal defects. [provided by RefSeq, Oct 2015]' Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. This variant also lacks an exon in the 5' coding region, compared to variant 1. The encoded isoform (3) has a distinct N-terminus, lacks a predicted signal peptide, and is shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC230101 | ALPL (Myc-DDK-tagged)-Human alkaline phosphatase, liver/bone/kidney (ALPL), transcript variant 3 |
USD 420.00 |
|
RG230101 | ALPL (GFP-tagged) - Human alkaline phosphatase, liver/bone/kidney (ALPL), transcript variant 3 |
USD 460.00 |
|
RC230101L3 | Lenti ORF clone of Human alkaline phosphatase, liver/bone/kidney (ALPL), transcript variant 3, Myc-DDK-tagged |
USD 620.00 |
|
RC230101L4 | Lenti ORF clone of Human alkaline phosphatase, liver/bone/kidney (ALPL), transcript variant 3, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review