FOXO4 (NM_001170931) Human Untagged Clone

CAT#: SC328743

FOXO4 (untagged)-Human forkhead box O4 (FOXO4) transcript variant 2


  "NM_001170931" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "FOXO4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FOXO4
Synonyms AFX; AFX1; MLLT7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001170931, the custom clone sequence may differ by one or more nucleotides


ATGGATCCGGGGAATGAGAATTCAGCCACAGAGGCTGCCGCGATCATAGACCTAGATCCCGACTTCGAAC
CCCAGAGCCGTCCCCGCTCCTGCACCTGGCCCCTTCCCCGACCAGAGATCGCTAACCAGCCGTCCGAGCC
GCCCGAGGTGGAGCCAGATCTGGGGGAAAAGGCCATTGAAAGCGCCCCGGAGAAGCGACTGACACTTGCC
CAGATCTACGAGTGGATGGTCCGTACTGTACCCTACTTCAAGGACAAGGGTGACAGCAACAGCTCAGCAG
GATGGAAGAACTCGATCCGCCACAACCTGTCCCTGCACAGCAAGTTCATCAAGGTTCACAACGAGGCCAC
CGGCAAAAGCTCTTGGTGGATGCTGAACCCTGAGGGAGGCAAGAGCGGCAAAGCCCCCCGCCGCCGGGCC
GCCTCCATGGATAGCAGCAGCAAGCTGCTCCGGGGCCGCAGTAAAGCCCCCAAGAAGAAACCATCTGTGC
TGCCAGCTCCACCCGAAGGTGCCACTCCAACGAGCCCTGTCGGCCACTTTGCCAAGTGGTCAGGCAGCCC
TTGCTCTCGAAACCGTGAAGAAGCCGATATGTGGACCACCTTCCGTCCACGAAGCAGTTCAAATGCCAGC
AGTGTCAGCACCCGGCTGTCCCCCTTGAGGCCAGAGTCTGAGGTGCTGGCGGAGGAAATACCAGCTTCAG
TCAGCAGTTATGCAGGGGGTGTCCCTCCCACCCTCAATGAAGGTCTAGAGCTGTTAGATGGGCTCAATCT
CACCTCTTCCCATTCCCTGCTATCTCGGAGTGGTCTCTCTGGCTTCTCTTTGCAGCATCCTGGGGTTACC
GGCCCCTTACACACCTACAGCAGCTCCCTTTTCAGCCCAGCAGAGGGGCCCCTGTCAGCAGGAGAAGGGT
GCTTCTCCAGCTCCCAGGCTCTGGAGGCCCTGCTCACCTCTGATACGCCACCACCCCCTGCTGACGTCCT
CATGACCCAGGTAGATCCCATTCTGTCCCAGGCTCCGACTCTTCTGTTGCTGGGGGGGCTTCCTTCCTCC
AGTAAGCTGGCCACGGGCGTCGGCCTGTGTCCCAAGCCCCTAGAGGCTCCAGGCCCCAGCAGTCTGGTTC
CCACCCTTTCTATGATAGCACCACCTCCAGTCATGGCAAGTGCCCCCATCCCCAAGGCTCTGGGGACTCC
TGTGCTCACACCCCCTACTGAAGCTGCAAGCCAAGACAGAATGCCTCAGGATCTAGATCTTGATATGTAT
ATGGAGAACCTGGAGTGTGACATGGATAACATCATCAGTGACCTCATGGATGAGGGCGAGGGACTGGACT
TCAACTTTGAGCCAGATCCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001170931
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001170931.1, NP_001164402.1
RefSeq Size 3200 bp
RefSeq ORF 1353 bp
Locus ID 4303
Cytogenetics Xq13.1
Protein Families Transcription Factors
Gene Summary 'This gene encodes a member of the O class of winged helix/forkhead transcription factor family. Proteins encoded by this class are regulated by factors involved in growth and differentiation indicating they play a role in these processes. A translocation involving this gene on chromosome X and the homolog of the Drosophila trithorax gene, encoding a DNA binding protein, located on chromosome 11 is associated with leukemia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]'
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region compared to variant 1. This results in a shorter protein (isoform 2 also known as isoform zeta) compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.