CP2c (TFCP2) (NM_001173453) Human Untagged Clone

CAT#: SC328744

TFCP2 (untagged)-Human transcription factor CP2 (TFCP2) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TFCP2
• Synonyms: LBP1C; LSF; LSF1D; SEF; TFCP2C
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001173453, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCTGGGCTCTGAAGCTGCCTCTGGCCGACGAAGTGATTGAATCCGGGTTGGTGCAGGACTTTGATG
  CTAGCCTGTCCGGGATCGGCCAGGAACTGGGTGCTGGTGCCTATAGCATGAGTGATGTCCTTGCATTGCC
  CATTTTTAAGCAAGAAGAGTCGAGTTTGCCTCCTGATAATGAGAATAAAATCCTGCCTTTTCAATATGTG
  CTTTGTGCTGCTACCTCTCCAGCAGTGAAACTCCATGATGAAACCCTAACGTATCTCAATCAAGGACAGT
  CTTATGAAATTCGAATGCTAGACAATAGGAAACTTGGAGAACTTCCAGAAATTAATGGCAAATTGGTGAA
  GAGTATATTCCGTGTGGTGTTCCATGACAGAAGGCTTCAGTACACTGAGCATCAGCAGCTAGAGGGCTGG
  AGGTGGAACCGACCTGGAGACAGAATTCTTGACATAGATATCCCGATGTCTGTGGGTATAATCGATCCTA
  GGGCTAATCCAACTCAACTAAATACAGTGGAGTTCCTGTGGGACCCTGCAAAGAGGACATCTGTGTTTAT
  TCAGCCCAAAGGTGCAGACAGAAAGCAAAAAACGGATAGGGAAAAAATGGAGAAACGAACACCTCATGAA
  AAGGAGAAATATCAGCCTTCCTATGAGACAACCATACTCACAGAGTGTTCTCCATGGCCCGAGATCACGT
  ATGTCAATAACTCCCCATCACCTGGCTTCAACAGTTCCCATAGCAGTTTTTCTCTTGGGGAAGGAAATGG
  TTCACCAAACCACCAGCCAGAGCCACCCCCTCCAGTCACAGATAACCTCTTACCAACAACCACACCTCAG
  GAAGCTCAGCAGTGGTTGCATCGAAATCGTTTTTCTACATTCACAAGGCTTTTCACAAACTTCTCAGGGG
  CAGATTTATTGAAATTAACTAGAGATGATGTGATCCAAATCTGTGGCCCTGCAGATGGAATCAGACTTTT
  TAATGCATTAAAAGGCCGGATGGTGCGTCCAAGGTTAACCATTTATGTTTGTCAGGAATCACTGCAGTTG
  AGGGAGCAGCAACAACAGCAGCAGCAACAGCAGCAGAAGCATGAGGATGGAGACTCAAATGGTACTTTCT
  TCGTTTACCATGCTATCTATCTAGAAGAACTAACAGCTGTTGAATTGACAGAAAAAATTGCTCAGCTTTT
  CAGCATTTCCCCTTGCCAGATCAGCCAGATTTACAAGCAGGGGCCAACAGGAATTCATGTGCTCATCAGT
  GATGAGATGATACAGAACTTTCAGGAAGAAGCATGTTTTATTCTGGACACAATGAAAGAAACCAATGATA
  GCTATCATATCATACTGAAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001173453
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001173453.1, NP_001166924.1
• RefSeq Size: 3559 bp
• RefSeq ORF: 1353 bp
• Locus ID: 7024
• Cytogenetics: 12q13.12-q13.13
• Protein Families: Transcription Factors
• Gene Summary: 'This gene encodes a transcription factor that binds the alpha-globin promoter and activates transcription of the alpha-globin gene. The encoded protein regulates erythroid gene expression, plays a role in the transcriptional switch of globin gene promoters, and it activates many other cellular and viral gene promoters. The gene product interacts with certain inflammatory response factors, and polymorphisms of this gene may be involved in the pathogenesis of Alzheimer's disease. [provided by RefSeq, Mar 2010]'
  Transcript Variant: This variant (3) lacks an alternate in-frame exon in the central coding region, and uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.