Iduronate 2 sulfatase (IDS) (NM_001166550) Human Untagged Clone
CAT#: SC328761
IDS (untagged)-Human iduronate 2-sulfatase (IDS) transcript variant 3
"NM_001166550" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IDS |
Synonyms | MPS2; SIDS |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001166550, the custom clone sequence may differ by one or more nucleotides
ATGCCTTTGCGCAGGAGACCTGACACCACCCGCCTGTACGACTTCAACTCCTACTGGAGGGTGCACGCTG GAAACTTCTCCACCATCCCCCAGTACTTCAAGGAGAATGGCTATGTGACCATGTCGGTGGGAAAAGTCTT TCACCCTGGGATATCTTCTAACCATACCGATGATTCTCCGTATAGCTGGTCTTTTCCACCTTATCATCCT TCCTCTGAGAAGTATGAAAACACTAAGACATGTCGAGGGCCAGATGGAGAACTCCATGCCAACCTGCTTT GCCCTGTGGATGTGCTGGATGTTCCCGAGGGCACCTTGCCTGACAAACAGAGCACTGAGCAAGCCATACA GTTGTTGGAAAAGATGAAAACGTCAGCCAGTCCTTTCTTCCTGGCCGTTGGGTATCATAAGCCACACATC CCCTTCAGATACCCCAAGGAATTTCAGAAGTTGTATCCCTTGGAGAACATCACCCTGGCCCCCGATCCCG AGGTCCCTGATGGCCTACCCCCTGTGGCCTACAACCCCTGGATGGACATCAGGCAACGGGAAGACGTCCA AGCCTTAAACATCAGTGTGCCGTATGGTCCAATTCCTGTGGACTTTCAGCGGAAAATCCGCCAGAGCTAC TTTGCCTCTGTGTCATATTTGGATACACAGGTCGGCCGCCTCTTGAGTGCTTTGGACGATCTTCAGCTGG CCAACAGCACCATCATTGCATTTACCTCGGATCATGGGTGGGCTCTAGGTGAACATGGAGAATGGGCCAA ATACAGCAATTTTGATGTTGCTACCCATGTTCCCCTGATATTCTATGTTCCTGGAAGGACGGCTTCACTT CCGGAGGCAGGCGAGAAGCTTTTCCCTTACCTCGACCCTTTTGATTCCGCCTCACAGTTGATGGAGCCAG GCAGGCAATCCATGGACCTTGTGGAACTTGTGTCTCTTTTTCCCACGCTGGCTGGACTTGCAGGACTGCA GGTTCCACCTCGCTGCCCCGTTCCTTCATTTCACGTTGAGCTGTGCAGAGAAGGCAAGAACCTTCTGAAG CATTTTCGATTCCGTGACTTGGAAGAGGATCCGTACCTCCCTGGTAATCCCCGTGAACTGATTGCCTATA GCCAGTATCCCCGGCCTTCAGACATCCCTCAGTGGAATTCTGACAAGCCGAGTTTAAAAGATATAAAGAT CATGGGCTATTCCATACGCACCATAGACTATAGGTATACTGTGTGGGTTGGCTTCAATCCTGATGAATTT CTAGCTAACTTTTCTGACATCCATGCAGGGGAACTGTATTTTGTGGATTCTGACCCATTGCAGGATCACA ATATGTATAATGATTCCCAAGGTGGAGATCTTTTCCAGTTGTTGATGCCTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001166550 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001166550.3, NP_001160022.1 |
RefSeq Size | 7595 bp |
RefSeq ORF | 1383 bp |
Locus ID | 3423 |
Cytogenetics | Xq28 |
Protein Families | Druggable Genome |
Protein Pathways | Glycosaminoglycan degradation, Lysosome, Metabolic pathways |
Gene Summary | 'This gene encodes a member of the sulfatase family of proteins. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. This enzyme is involved in the lysosomal degradation of heparan sulfate and dermatan sulfate. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]' Transcript Variant: This variant (3) uses an alternate acceptor splice site in the 5' coding region, which results in translation initiation from a downstream initiation codon compared to variant 1. The encoded isoform (c) has a shorter and distinct N-terminus, and lacks a predicted signal peptide compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC230123 | IDS (Myc-DDK-tagged)-Human iduronate 2-sulfatase (IDS), transcript variant 3 |
USD 430.00 |
|
RG230123 | IDS (GFP-tagged) - Human iduronate 2-sulfatase (IDS), transcript variant 3 |
USD 470.00 |
|
RC230123L3 | Lenti ORF clone of Human iduronate 2-sulfatase (IDS), transcript variant 3, Myc-DDK-tagged |
USD 630.00 |
|
RC230123L4 | Lenti ORF clone of Human iduronate 2-sulfatase (IDS), transcript variant 3, mGFP tagged |
USD 630.00 |
{0} Product Review(s)
Be the first one to submit a review