ZNF185 (NM_001178113) Human Untagged Clone

CAT#: SC328770

ZNF185 (untagged)-Human zinc finger protein 185 (LIM domain) (ZNF185) transcript variant 7


  "NM_001178113" in other vectors (4)

Reconstitution Protocol

USD 780.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ZNF185"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZNF185
Synonyms SCELL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001178113, the custom clone sequence may differ by one or more nucleotides


ATGACCACTGAGGATTACAAGAAGCTGGCACCCTACAATATCAGGCGCAGCTCTACATCAGGGGACACCG
AGGAGGAGGAGGAGGAGGAGGTGGTGCCATTCTCCTCAGATGAACAGAAACGGAGCAGTCCTACCCAGGA
GACACAGGCACCGTTTATCGCGAAGAGGGTGGAGGTGGTGGAAGAGGACGGGCCTTCTGAGAAGAGCCAG
GACCCACCTGCTCTGGCAAGATCCACTCCTGGCTCAAACAGGTCTTCCCCAGGCAACAAAGACAAGGAGG
CCCCCTGCTCCAGAGAGCTCCAGAGGGACTTGGCTGGTGAGGAGGCTTTCAGGGCCCCCAACACAGATGC
TGCAAGGTCAAGTGCACAGTTGAGTGATGGCAATGTGGGATCCGGAGCCACGGGCTCCCGGCCTGAAGGC
TTGGCTGCAGTAGACATCGGCTCCGAGAGAGGAAGCTCCAGTGCCACTTCAGTCTCTGCTGTCCCTGCTG
ATAGGAAGAGCAACAGCACAGCAGCCCAGGAGGATGCAAAGGCAGACCCAAAGGGGGCCTTGGCTGATTA
TGAGGGGAAGGATGTGGCCACCAGGGTCGGAGAGGCCTGGCAGGAGAGGCCTGGAGCTCCAAGAGGTGGC
CAAGGAGACCCAGCTGTACCCGCTCAGCAACCTGCAGATCCCAGCACCCCAGAGCGGCAGAGCAGCCCCA
GCGGATCTGAGCAACTTGTCAGACGAGAGAGTTGTGGCAGCAGCGTGTTGACTGATTTTGAGGGGAAGGA
TGTGGCCACCAAGGTCGGAGAGGCCTGGCAGGACAGGCCTGGAGCCCCAAGAGGTGGCCAAGGAGACCCA
GCTGTACCCACTCAGCAACCTGCAGATCCCAGTACCCCAGAACAGCAGAACAGCCCCAGCGGATCTGAGC
AATTCGTCAGACGAGAGAGCTGCACCAGCAGGGTGAGGAGCCCCTCGAGCTGCATGGTCACTGTTACTGT
CACTGCCACATCTGAGCAGCCTCACATTTATATTCCAGCCCCCGCAAGTGAATTGGACTCCAGCTCTACC
ACCAAAGGGATTCTCTTCGTGAAGGAGTACGTGAATGCTAGTGAAGTGTCTTCTGGGAAGCCAGTATCTG
CACGCTATAGCAACGTCAGCAGCATTGAGGACTCATTCGCCATGGAGAAGAAGCCTCCATGTGGCAGCAC
TCCATACTCTGAGAGGACAACTGGAGGGATCTGTACTTACTGCAACCGTGAGATCCGAGACTGTCCAAAG
ATTACCCTAGAACATCTTGGTATCTGCTGCCATGAATATTGCTTTAAGTGTGGGATTTGCAGTAAACCGA
TGGGCGATCTCCTGGATCAGATCTTCATTCACCGTGACACCATTCACTGTGGGAAATGCTATGAGAAGCT
CTTCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001178113
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001178113.1, NP_001171584.1
RefSeq Size 3897 bp
RefSeq ORF 1407 bp
Locus ID 7739
Cytogenetics Xq28
Gene Summary 'Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This gene encodes a LIM-domain zinc finger protein. The LIM domain is composed of two contiguous zinc finger domains, separated by a two-amino acid residue hydrophobic linker. The LIM domain mediates protein:protein interactions. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, May 2010]'
Transcript Variant: This variant (7) differs in the 5' UTR and has multiple differences in the 5' coding region including a downstream in-frame AUG start codon, as compared to variant 1. The resulting isoform (7) has a much shorter N-terminus and an additional aa in one region, and lacks three segments in other regions, as compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.