Hyaluronidase PH20 (SPAM1) (NM_001174044) Human Untagged Clone

CAT#: SC328840

SPAM1 (untagged)-Human sperm adhesion molecule 1 (PH-20 hyaluronidase zona pellucida binding) (SPAM1) transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SPAM1
• Synonyms: HEL-S-96n; HYA1; HYAL1; HYAL3; HYAL5; PH-20; PH20; SPAG15
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001174044, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGAGTGCTAAAATTCAAGCACATCTTTTTCAGAAGCTTTGTTAAATCAAGTGGAGTATCCCAGATAG
  TTTTCACCTTCCTTCTGATTCCATGTTGCTTGACTCTGAATTTCAGAGCACCTCCTGTTATTCCAAATGT
  GCCTTTCCTCTGGGCCTGGAATGCCCCAAGTGAATTTTGTCTTGGAAAATTTGATGAGCCACTAGATATG
  AGCCTCTTCTCTTTCATAGGAAGCCCCCGAATAAACGCCACCGGGCAAGGTGTTACAATATTTTATGTTG
  ATAGACTTGGCTACTATCCTTACATAGATTCAATCACAGGAGTAACTGTGAATGGAGGAATCCCCCAGAA
  GATTTCCTTACAAGACCATCTGGACAAAGCTAAGAAAGACATTACATTTTATATGCCAGTAGACAATTTG
  GGAATGGCTGTTATTGACTGGGAAGAATGGAGACCCACTTGGGCAAGAAACTGGAAACCTAAAGATGTTT
  ACAAGAATAGGTCTATTGAATTGGTTCAGCAACAAAATGTACAACTTAGTCTCACAGAGGCCACTGAGAA
  AGCAAAACAAGAATTTGAAAAGGCAGGGAAGGATTTCCTGGTAGAGACTATAAAATTGGGAAAATTACTT
  CGGCCAAATCACTTGTGGGGTTATTATCTTTTTCCGGATTGTTACAACCATCACTATAAGAAACCCGGTT
  ACAATGGAAGTTGCTTCAATGTAGAAATAAAAAGAAATGATGATCTCAGCTGGTTGTGGAATGAAAGCAC
  TGCTCTTTACCCATCCATTTATTTGAACACTCAGCAGTCTCCTGTAGCTGCTACACTCTATGTGCGCAAT
  CGAGTTCGGGAAGCCATCAGAGTTTCCAAAATACCTGATGCAAAAAGTCCACTTCCGGTTTTTGCATATA
  CCCGCATAGTTTTTACTGATCAAGTTTTGAAATTCCTTTCTCAAGATGAACTTGTGTATACATTTGGCGA
  AACTGTTGCTCTGGGTGCTTCTGGAATTGTAATATGGGGAACCCTCAGTATAATGCGAAGTATGAAATCT
  TGCTTGCTCCTAGACAATTACATGGAGACTATACTGAATCCTTACATAATCAACGTCACACTAGCAGCCA
  AAATGTGTAGCCAAGTGCTTTGCCAGGAGCAAGGAGTGTGTATAAGGAAAAACTGGAATTCAAGTGACTA
  TCTTCACCTCAACCCAGATAATTTTGCTATTCAACTTGAGAAAGGTGGAAAGTTCACAGTACGTGGAAAA
  CCGACACTTGAAGACCTGGAGCAATTTTCTGAAAAATTTTATTGCAGCTGTTATAGCACCTTGAGTTGTA
  AGGAGAAAGCTGATGTAAAAGACACTGATGCTGTTGATGTGTGTATTGCTGATGGTGTCTGTATAGATGC
  TTTTCTAAAACCTCCCATGGAGACAGAAGAACCTCAAATTTTCTACAATGCTTCACCCTCCACACTATCT
  GCCACAATGTTCATTGTTAGTATTTTGTTTCTTATCATTTCTTCTGTAGCGAGTTTGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001174044
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001174044.1, NP_001167515.1
• RefSeq Size: 2241 bp
• RefSeq ORF: 1530 bp
• Locus ID: 6677
• Cytogenetics: 7q31.32
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Glycosaminoglycan degradation, Metabolic pathways
• Gene Summary: 'Hyaluronidase degrades hyaluronic acid, a major structural proteoglycan found in extracellular matrices and basement membranes. Six members of the hyaluronidase family are clustered into two tightly linked groups on chromosome 3p21.3 and 7q31.3. This gene was previously referred to as HYAL1 and HYA1 and has since been assigned the official symbol SPAM1; another family member on chromosome 3p21.3 has been assigned HYAL1. This gene encodes a GPI-anchored enzyme located on the human sperm surface and inner acrosomal membrane. This multifunctional protein is a hyaluronidase that enables sperm to penetrate through the hyaluronic acid-rich cumulus cell layer surrounding the oocyte, a receptor that plays a role in hyaluronic acid induced cell signaling, and a receptor that is involved in sperm-zona pellucida adhesion. Abnormal expression of this gene in tumors has implicated this protein in degradation of basement membranes leading to tumor invasion and metastasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]'
  Transcript Variant: This variant (3) differs in the 5' UTR and uses an alternate splice pattern in the 3' coding region and 3' UTR, compared to variant 1, resulting in a shorter and distinct C-terminus (isoform 2). Variants 2-5 all encode the same isoform.