HCK (NM_001172130) Human Untagged Clone

CAT#: SC328869

HCK (untagged)-Human hemopoietic cell kinase (HCK) transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HCK
• Synonyms: JTK9; p59Hck; p61Hck
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001172130, the custom clone sequence may differ by one or more nucleotides
  
  
  CTGGGGGGGCGCTCAAGCTGCGAGGATCCGGGCTGCCCGCGAGACGAGGAGCGGGCGCCCAGGATGGGGT
  GCATGAAGTCCAAGTTCCTCCAGGTCGGAGGCAATACATTCTCAAAAACTGAAACCAGCGCCAGCCCACA
  CTGTCCTGTGTACGTGCCGGATCCCACATCCACCATCAAGCCGGGGCCTAATAGCCACAACAGCAACACA
  CCAGGAATCAGGGAGGGCTCTGAGGACATCATCGTGGTTGCCCTGTATGATTACGAGGCCATTCACCACG
  AAGACCTCAGCTTCCAGAAGGGGGACCAGATGGTGGTCCTAGAGGAATCCGGGGAGTGGTGGAAGGCTCG
  ATCCCTGGCCACCCGGAAGGAGGGCTACATCCCAAGCAACTATGTCGCCCGCGTTGACTCTCTGGAGACA
  GAGGAGTGGTTTTTCAAGGGCATCAGCCGGAAGGACGCAGAGCGCCAACTGCTGGCTCCCGGCAACATGC
  TGGGCTCCTTCATGATCCGGGATAGCGAGACCACTAAAGGAAGCTACTCTTTGTCCGTGCGAGACTACGA
  CCCTCGGCAGGGAGATACCGTGAAACATTACAAGATCCGGACCCTGGACAACGGGGGCTTCTACATATCC
  CCCCGAAGCACCTTCAGCACTCTGCAGGAGCTGGTGGACCACTACAAGAAGGGGAACGACGGGCTCTGCC
  AGAAACTGTCGGTGCCCTGCATGTCTTCCAAGCCCCAGAAGCCTTGGGAGAAAGATGCCTGGGAGATCCC
  TCGGGAATCCCTCAAGCTGGAGAAGAAACTTGGAGCTGGGCAGTTTGGGGAAGTCTGGATGGCCACCTAC
  AACAAGCACACCAAGGTGGCAGTGAAGACGATGAAGCCAGGGAGCATGTCGGTGGAGGCCTTCCTGGCAG
  AGGCCAACGTGATGAAAACTCTGCAGCATGACAAGCTGGTCAAACTTCATGCGGTGGTCACCAAGGAGCC
  CATCTACATCATCACGGAGTTCATGGCCAAAGGAAGCTTGCTGGACTTTCTGAAAAGTGATGAGGGCAGC
  AAGCAGCCATTGCCAAAACTCATTGACTTCTCAGCCCAGATTGCAGAAGGCATGGCCTTCATCGAGCAGA
  GGAACTACATCCACCGAGACCTCCGAGCTGCCAACATCTTGGTCTCTGCATCCCTGGTGTGTAAGATTGC
  TGACTTTGGCCTGGCCCGGGTCATTGAGGACAACGAGTACACGGCTCGGGAAGGGGCCAAGTTCCCCATC
  AAGTGGACAGCTCCTGAAGCCATCAACTTTGGCTCCTTCACCATCAAGTCAGACGTCTGGTCCTTTGGTA
  TCCTGCTGATGGAGATCGTCACCTACGGCCGGATCCCTTACCCAGGGATGTCAAACCCTGAAGTGATCCG
  AGCTCTGGAGCGTGGATACCGGATGCCTCGCCCAGAGAACTGCCCAGAGGAGCTCTACAACATCATGATG
  CGCTGCTGGAAAAACCGTCCGGAGGAGCGGCCGACCTTCGAATACATCCAGAGTGTGCTGGATGACTTCT
  ACACGGCCACAGAGAGCCAGTACCAACAGCAGCCATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001172130
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001172130.1, NP_001165601.1
• RefSeq Size: 2165 bp
• RefSeq ORF: 1578 bp
• Locus ID: 3055
• Cytogenetics: 20q11.21
• Protein Families: Druggable Genome, Protein Kinase
• Protein Pathways: Chemokine signaling pathway, Fc gamma R-mediated phagocytosis
• Gene Summary: 'The protein encoded by this gene is a member of the Src family of tyrosine kinases. This protein is primarily hemopoietic, particularly in cells of the myeloid and B-lymphoid lineages. It may help couple the Fc receptor to the activation of the respiratory burst. In addition, it may play a role in neutrophil migration and in the degranulation of neutrophils. Multiple isoforms with different subcellular distributions are produced due to both alternative splicing and the use of alternative translation initiation codons, including a non-AUG (CUG) codon. [provided by RefSeq, Feb 2010]'
  Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. This variant encodes two isoforms due to the use of alternative translation initiation codons, as demonstrated in PMIDs 1875927 and 7791757. The longer isoform (c) is derived from an upstream non-AUG (CUG) start codon, while the shorter isoform (d) is derived from a downstream AUG start codon. The longer isoform (c) is represented in this RefSeq, but it is overall shorter, compared to isoform a. CCDS Note: This CCDS, which is supported by the mRNAs AK289896.1 and BC113854.1, represents a long human HCK isoform, as described in PMIDs 1875927 and 7791757. This isoform initiates translation from a non-AUG (CUG) start codon that is well-conserved and present in a strong Kozak signal context. Alternative translation initiation from a downstream AUG start codon produces an isoform that is 21 aa shorter at the N-terminus. The shorter isoform encoded by this variant is represented by CCDS 54456.1. These isoforms exhibit distinct subcellular distributions, as indicated in PMID:7791757.