PPP2R1B (NM_001177562) Human Untagged Clone

CAT#: SC328903

PPP2R1B (untagged)-Human protein phosphatase 2 regulatory subunit A beta (PPP2R1B) transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PPP2R1B
• Synonyms: PP2A-Abeta; PR65B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001177562, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGGCGCATCAGAGCTCGGGACCGGCCCAGGAGCAGCGGGTGGAGATGGAGATGATTCGCTATACC
  CGATCGCGGTTTTAATCGACGAGCTCCGCAATGAAGACGTGCAGCTCCGACTCAACAGTATTAAGAAGTT
  ATCAACAATTGCCCTAGCACTTGGAGTAGAAAGGACCCGAAGTGAATTGTTGCCATTTCTTACAGATACA
  ATTTATGATGAAGATGAGGTACTATTAGCTCTTGCTGAGCAGCTGGGAAATTTCACTGGCCTAGTGGGAG
  GTCCTGACTTTGCCCACTGTCTGCTGCCTCCTTTGGAAAATCTGGCAACTGTGGAAGAGACTGTTGTTCG
  TGACAAGGCTGTGGAGTCCCTGAGACAGATCTCCCAGGAGCATACTCCTGTTGCTCTGGAAGCTTATTTT
  GTACCTCTGGTGAAACGCTTAGCAAGTGGGGATTGGTTCACCTCTCGCACATCTGCATGTGGTTTGTTCA
  GCGTTTGCTATCCCAGGGCATCAAATGCTGTTAAAGCAGAAATCAGACAGCAATTCCGTTCCTTGTGCTC
  AGATGACACACCAATGGTACGACGTGCTGCTGCTTCCAAATTGGGTGAATTTGCAAAAGTTTTGGAATTA
  GACAGTGTGAAAAGTGAAATTGTTCCACTGTTCACTAGTCTAGCTTCAGATGAACAGGATTCAGTGCGCC
  TCCTTGCTGTGGAAGCTTGTGTCAGTATTGCCCAGTTATTGTCTCAGGATGACCTTGAGACTTTGGTGAT
  GCCTACACTTCGACAAGCAGCAGAAGATAAATCTTGGCGCGTTCGCTATATGGTGGCTGACAGATTTTCA
  GAGCTCCAGAAAGCCATGGGTCCTAAAATCACCCTAAATGACCTCATCCCCGCCTTTCAGAACCTACTTA
  AAGACTGTGAAGCTGAAGTCCGGGCAGCTGCTGCCCACAAAGTAAAAGAACTTGGTGAGAACTTGCCCAT
  TGAAGATAGAGAGACCATAATTATGAATCAAATTCTGCCTTATATAAAGTGTCCTGACGTTCGTTTGAAT
  ATCATCTCCAATTTGGATTGTGTAAATGAAGTGATTGGAATCCGTCAGCTCTCTCAGTCTCTCCTTCCTG
  CCATAGTGGAGCTGGCAGAAGATGCCAAATGGAGGGTCCGCCTGGCCATCATTGAGTATATGCCGCTGCT
  GGCAGGCCAGCTGGGTGTGGAATTCTTTGATGAAAAGCTGAATTCTTTATGTATGGCTTGGCTCGTGGAC
  CATGTATACGCCATCCGAGAAGCTGCCACCAACAACCTCATGAAACTAGTTCAGAAGTTTGGTACAGAGT
  GGGCCCAAAATACTATTGTTCCCAAAGTGTTAGTAATGGCAAATGATCCTAATTACTTGCATAGAATGAC
  CACTTTATTCTGCATTAATGCACTGTCTGAGGCCTGTGGTCAGGAAATAACTACTAAGCAAATGCTGCCC
  ATCGTATTAAAAATGGCAGGAGACCAAGTAGCAAATGTTCGCTTCAATGTGGCCAAATCTCTACAAAAGA
  TTGGACCAATTCTAGATACCAATGCTTTACAGGGAGAAGTGAAGCCAGTACTACAGAAGTTAGGTCAAGA
  TGAAGACATGGATGTCAAATACTTTGCACAGGAAGCTATAAGTGTTCTTGCATTGGCATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001177562
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001177562.1, NP_001171033.1
• RefSeq Size: 5470 bp
• RefSeq ORF: 1671 bp
• Locus ID: 5519
• Cytogenetics: 11q23.1
• Protein Families: Druggable Genome, Phosphatase, Transcription Factors
• Protein Pathways: Long-term depression, Oocyte meiosis, TGF-beta signaling pathway, Tight junction, Wnt signaling pathway
• Gene Summary: 'This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes a beta isoform of the constant regulatory subunit A. Mutations in this gene have been associated with some lung and colon cancers. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]'
  Transcript Variant: This variant (4) lacks an in-frame exon in the coding region compared to variant 1. The resulting isoform (d) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.