CD19 (NM_001178098) Human Untagged Clone
CAT#: SC328905
CD19 (untagged)-Human CD19 molecule (CD19) transcript variant 1
"NM_001178098" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CD19 |
Synonyms | B4; CVID3 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001178098 edited
AGGCCCCTGCCTGCCCCAGCATCCCCTGCGCGAAGCTGGGTGCCCCGGAGAGTCTGACCA CCATGCCACCTCCTCGCCTCCTCTTCTTCCTCCTCTTCCTCACCCCCATGGAAGTCAGGC CCGAGGAACCTCTAGTGGTGAAGGTGGAAGAGGGAGATAACGCTGTGCTGCAGTGCCTCA AGGGGACCTCAGATGGCCCCACTCAGCAGCTGACCTGGTCTCGGGAGTCCCCGCTTAAAC CCTTCTTAAAACTCAGCCTGGGGCTGCCAGGCCTGGGAATCCACATGAGGCCCCTGGCCA TCTGGCTTTTCATCTTCAACGTCTCTCAACAGATGGGGGGCTTCTACCTGTGCCAGCCGG GGCCCCCCTCTGAGAAGGCCTGGCAGCCTGGCTGGACAGTCAATGTGGAGGGCAGCGGGG AGCTGTTCCGGTGGAATGTTTCGGACCTAGGTGGCCTGGGCTGTGGCCTGAAGAACAGGT CCTCAGAGGGCCCCAGCTCCCCTTCCGGGAAGCTCATGAGCCCCAAGCTGTATGTGTGGG CCAAAGACCGCCCTGAGATCTGGGAGGGAGAGCCTCCGTGTCTCCCACCGAGGGACAGCC TGAACCAGAGCCTCAGCCAGGACCTCACCATGGCCCCTGGCTCCACACTCTGGCTGTCCT GTGGGGTACCCCCTGACTCTGTGTCCAGGGGCCCCCTCTCCTGGACCCATGTGCACCCCA AGGGGCCTAAGTCATTGCTGAGCCTAGAGCTGAAGGACGATCGCCCGGCCAGAGATATGT GGGTAATGGAGACGGGTCTGTTGTTGCCCCGGGCCACAGCTCAAGACGCTGGAAAGTATT ATTGTCACCGTGGCAACCTGACCATGTCATTCCACCTGGAGATCACTGCTCGGCCAGTAC TATGGCACTGGCTGCTGAGGACTGGTGGCTGGAAGGTCTCAGCTGTGACTTTGGCTTATC TGATCTTCTGCCTGTGTTCCCTTGTGGGCATTCTTCATCTTCAAAGAGCCCTGGTCCTGA GGAGGAAAAGAAAGCGAATGACTGACCCCACCAGGAGATTCTTCAAAGTGACGCCTCCCC CAGGAAGCGGGCCCCAGAACCAGTACGGGAACGTGCTGTCTCTCCCCACACCCACCTCAG GCCTCGGACGCGCCCAGCGTTGGGCCGCAGGCCTGGGGGGCACTGCCCCGTCTTATGGAA ACCCGAGCAGCGACGTCCAGGCGGATGGAGCCTTGGGGTCCCGGAGCCCGCCGGGAGTGG GCCCAGAAGAAGAGGAAGGGGAGGGCTATGAGGAACCTGACAGTGAGGAGGACTCCGAGT TCTATGAGAACGACTCCAACCTTGGGCAGGACCAGCTCTCCCAGGATGGCAGCGGCTACG AGAACCCTGAGGATGAGCCCCTGGGTCCTGAGGATGAAGACTCCTTCTCCAACGCTGAGT CTTATGAGAACGAGGATGAAGAGCTGACCCAGCCGGTCGCCAGGACAATGGACTTCCTGA GCCCTCATGGGTCAGCCTGGGACCCCAGCCGGGAAGCAACCTCCCTGGCAGGGTCCCAGT CCTATGAGGATATGAGAGGAATCCTGTATGCAGCCCCCCAGCTCCGCTCCATTCGGGGCC AGCCTGGACCCAATCATGAGGAAGATGCAGACTCTTATGAGAACATGGATAATCCCGATG GGCCAGACCCAGCCTGGGGAGGAGGGGGCCGCATGGGCACCTGGAGCACCAGGTGATCCT CAGGTGGCCAGCCTGGATCTCCTCAAGTCCCCAAGATTCACACCTGACTCTGAAATCTGA AGACCTCGAC |
Restriction Sites | Please inquire |
ACCN | NM_001178098 |
Insert Size | 1800 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001178098.1. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001178098.1, NP_001171569.1 |
RefSeq Size | 1968 bp |
RefSeq ORF | 1674 bp |
Locus ID | 930 |
Cytogenetics | 16p11.2 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | B cell receptor signaling pathway, Hematopoietic cell lineage, Primary immunodeficiency |
Gene Summary | 'This gene encodes a member of the immunoglobulin gene superfamily. Expression of this cell surface protein is restricted to B cell lymphocytes. This protein is a reliable marker for pre-B cells but its expression diminishes during terminal B cell differentiation in antibody secreting plasma cells. The protein has two N-terminal extracellular Ig-like domains separated by a non-Ig-like domain, a hydrophobic transmembrane domain, and a large C-terminal cytoplasmic domain. This protein forms a complex with several membrane proteins including complement receptor type 2 (CD21) and tetraspanin (CD81) and this complex reduces the threshold for antigen-initiated B cell activation. Activation of this B-cell antigen receptor complex activates the phosphatidylinositol 3-kinase signalling pathway and the subsequent release of intracellular stores of calcium ions. This protein is a target of chimeric antigen receptor (CAR) T-cells used in the treatment of lymphoblastic leukemia. Mutations in this gene are associated with the disease common variable immunodeficiency 3 (CVID3) which results in a failure of B-cell differentiation and impaired secretion of immunoglobulins. CVID3 is characterized by hypogammaglobulinemia, an inability to mount an antibody response to antigen, and recurrent bacterial infections. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2020]' Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC230267 | CD19 (Myc-DDK-tagged)-Human CD19 molecule (CD19), transcript variant 1 |
USD 420.00 |
|
RG230267 | CD19 (GFP-tagged) - Human CD19 molecule (CD19), transcript variant 1 |
USD 460.00 |
|
RC230267L1 | Lenti-ORF clone of CD19 (Myc-DDK-tagged)-Human CD19 molecule (CD19), transcript variant 1 |
USD 620.00 |
|
RC230267L2 | Lenti-ORF clone of CD19 (mGFP-tagged)-Human CD19 molecule (CD19), transcript variant 1 |
USD 768.00 |
|
RC230267L3 | Lenti-ORF clone of CD19 (Myc-DDK-tagged)-Human CD19 molecule (CD19), transcript variant 1 |
USD 620.00 |
|
RC230267L4 | Lenti-ORF clone of CD19 (mGFP-tagged)-Human CD19 molecule (CD19), transcript variant 1 |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review