TMEM127 (NM_001193304) Human Untagged Clone

CAT#: SC329396

TMEM127 (untagged) - Homo sapiens transmembrane protein 127 (TMEM127), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TMEM127
• Synonyms: FLJ20507; FLJ22257
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001193304, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTACGCCCCCGGAGGCGCAGGGCTGCCCGGCGGGCGCCGGCGGAGGAGCCCGGGAGGCAGCGCTCTGC
  CCAAGCAGCCGGAGCGTAGCCTGGCCTCGGCCCTGCCTGGCGCCCTGTCTATCACGGCGCTGTGCACTGC
  CCTCGCCGAGCCCGCCTGGTTGCACATCCACGGAGGCACCTGTTCGCGCCAGGAGCTGGGGGTCTCCGAC
  GTGTTGGGCTATGTGCACCCGGACCTGCTGAAAGATTTCTGCATGAATCCCCAGACAGTGCTGCTCCTGC
  GGGTCATCGCCGCCTTCTGTTTCCTGGGCATCCTGTGTAGTCTCTCCGCTTTCCTTCTGGATGTCTTTGG
  GCCGAAGCATCCTGCTCTGAAGATCACTCGTCGCTATGCCTTCGCCCATATCCTAACGGTTCTGCAGTGT
  GCCACCGTCATTGGCTTTTCTTATTGGGCTTCTGAACTCATCTTGGCCCAGCAGCAGCAGCATAAGAAGT
  ACCATGGATCCCAGGTCTATGTCACCTTCGCCGTTAGCTTCTACCTGGTGGCAGGAGCTGGTGGAGCCTC
  AATCCTGGCCACGGCAGCCAACCTCCTGCGCCACTACCCCACAGAGGAAGAGGAGCAGGCGCTGGAGCTG
  CTCTCAGAGATGGAAGAGAACGAGCCCTACCCGGCGGAATATGAGGTCATCAACCAGTTCCAGCCACCCC
  CTGCTTACACACCCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001193304
• ORF Size: 717 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001193304.2, NP_001180233.1
• RefSeq Size: 4570
• RefSeq ORF: 717
• Locus ID: 55654
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a transmembrane protein with 3 predicted transmembrane domains. The protein is associated with a subpopulation of vesicular organelles corresponding to early endosomal structures, with the Golgi, and with lysosomes, and may participate in protein trafficking between these structures. Mutations in this gene and several other genes cause pheochromocytomas. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Aug 2010]
  Transcript Variant: This variant (2) has an alternate splice site, resulting in a shorter 5' UTR, as compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.