WNT5A (NM_001256105) Human Untagged Clone

CAT#: SC329400

WNT5A (untagged) - Homo sapiens wingless-type MMTV integration site family, member 5A (WNT5A), transcript variant 2


  "NM_001256105" in other vectors (2)

Reconstitution Protocol

USD 370.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "WNT5A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol WNT5A
Synonyms hWNT5A
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256105, the custom clone sequence may differ by one or more nucleotides


ATGGCTGGAAGTGCAATGTCTTCCAAGTTCTTCCTAGTGGCTTTGGCCATATTTTTCTCCTTCGCCCAGG
TTGTAATTGAAGCCAATTCTTGGTGGTCGCTAGGTATGAATAACCCTGTTCAGATGTCAGAAGTATATAT
TATAGGAGCACAGCCTCTCTGCAGCCAACTGGCAGGACTTTCTCAAGGACAGAAGAAACTGTGCCACTTG
TATCAGGACCACATGCAGTACATCGGAGAAGGCGCGAAGACAGGCATCAAAGAATGCCAGTATCAATTCC
GACATCGAAGGTGGAACTGCAGCACTGTGGATAACACCTCTGTTTTTGGCAGGGTGATGCAGATAGGCAG
CCGCGAGACGGCCTTCACATACGCGGTGAGCGCAGCAGGGGTGGTGAACGCCATGAGCCGGGCGTGCCGC
GAGGGCGAGCTGTCCACCTGCGGCTGCAGCCGCGCCGCGCGCCCCAAGGACCTGCCGCGGGACTGGCTCT
GGGGCGGCTGCGGCGACAACATCGACTATGGCTACCGCTTTGCCAAGGAGTTCGTGGACGCCCGCGAGCG
GGAGCGCATCCACGCCAAGGGCTCCTACGAGAGTGCTCGCATCCTCATGAACCTGCACAACAACGAGGCC
GGCCGCAGGACGGTGTACAACCTGGCTGATGTGGCCTGCAAGTGCCATGGGGTGTCCGGCTCATGTAGCC
TGAAGACATGCTGGCTGCAGCTGGCAGACTTCCGCAAGGTGGGTGATGCCCTGAAGGAGAAGTACGACAG
CGCGGCGGCCATGCGGCTCAACAGCCGGGGCAAGTTGGTACAGGTCAACAGCCGCTTCAACTCGCCCACC
ACACAAGACCTGGTCTACATCGACCCCAGCCCTGACTACTGCGTGCGCAATGAGAGCACCGGCTCGCTGG
GCACGCAGGGCCGCCTGTGCAACAAGACGTCGGAGGGCATGGATGGCTGCGAGCTCATGTGCTGCGGCCG
TGGCTACGACCAGTTCAAGACCGTGCAGACGGAGCGCTGCCACTGCAAGTTCCACTGGTGCTGCTACGTC
AAGTGCAAGAAGTGCACGGAGATCGTGGACCAGTTTGTGTGCAAGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001256105
ORF Size 1098 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256105.1, NP_001243034.1
RefSeq Size 5599
RefSeq ORF 1098
Locus ID 7474
Protein Families Adult stem cells, Cancer stem cells, Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein, Stem cell relevant signaling - Wnt Signaling pathway
Protein Pathways Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway
Gene Summary The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene encodes a member of the WNT family that signals through both the canonical and non-canonical WNT pathways. This protein is a ligand for the seven transmembrane receptor frizzled-5 and the tyrosine kinase orphan receptor 2. This protein plays an essential role in regulating developmental pathways during embryogenesis. This protein may also play a role in oncogenesis. Mutations in this gene are the cause of autosomal dominant Robinow syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (2) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.