Claudin 12 (CLDN12) (NM_001185072) Human Untagged Clone

CAT#: SC329412

CLDN12 (untagged) - Homo sapiens claudin 12 (CLDN12), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLDN12
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001185072, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCTGTCGGGATGTCCACGCAGCCACAGTCCTTTCCTTCCTGTGTGGAATCGCCTCAGTAGCAGGCC
  TCTTTGCAGGGACTCTGCTTCCCAACTGGAGAAAATTACGATTGATCACATTCAACAGAAACGAGAAGAA
  CCTGACTGTTTACACAGGCCTGTGGGTGAAATGTGCCCGGTATGACGGGAGCAGTGACTGCCTGATGTAC
  GACACTACTTGGTACTCATCAGTTGACCAGCTGGACCTGCGTGTCCTCCAGTTTGCCCTACCCCTCAGCA
  TGCTGATCGCCATGGGTGCCCTGCTGCTCTGCCTGATTGGAATGTGCAACACTGCCTTCAGGTCCTCGGT
  GCCCAACATCAAACTGGCCAAGTGTCTGGTCAATAGTGCAGGTTGCCACCTGGTGGCTGGGCTGCTATTT
  TTCCTGGCAGGTACTGTGAGCCTCTCCCCATCTATCTGGGTCATCTTTTATAACATCCATCTGAACAAGA
  AGTTTGAGCCAGTCTTTTCATTTGACTATGCAGTGTATGTCACTATTGCTAGTGCTGGGGGCCTGTTTAT
  GACTTCCCTTATACTATTTATTTGGTATTGTACATGCAAATCTTTGCCTTCTCCTTTCTGGCAACCATTG
  TACTCCCATCCACCCAGTATGCATACTTACTCACAGCCCTATTCAGCACGCTCTCGCCTCTCTGCCATTG
  AAATTGACATTCCAGTAGTTTCACACACCACTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001185072
• ORF Size: 735 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001185072.2, NP_001172001.1
• RefSeq Size: 3684
• RefSeq ORF: 735
• Locus ID: 9069
• Protein Families: Transmembrane
• Gene Summary: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is expressed in the inner ear and bladder epithelium, and it is over-expressed in colorectal carcinomas. This protein and claudin 2 are critical for vitamin D-dependent Ca2+ absorption between enterocytes. Multiple alternatively spliced transcript variants encoding the same protein have been found. [provided by RefSeq, Sep 2011]
  Transcript Variant: This variant (1) is the longest transcript. Variants 1-3 encode the same protein.