PFD6 (PFDN6) (NM_001185181) Human Untagged Clone

CAT#: SC329414

PFDN6 (untagged) - Homo sapiens prefoldin subunit 6 (PFDN6), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PFDN6
• Synonyms: H2-KE2; HKE2; KE-2; PFD6
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001185181, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGAGCTGATCCAGAAGAAGCTACAGGGAGAAGTGGAGAAATATCAACAGCTACAGAAGGACTTAA
  GTAAATCCATGTCGGGGAGGCAGAAACTTGAAGCACAACTAACAGAAAATAATATCGTGAAAGAGGAACT
  GGCCCTGCTGGATGGGTCCAACGTGGTCTTTAAACTTCTGGGTCCGGTGCTAGTCAAACAGGAGCTGGGG
  GAGGCTCGGGCCACAGTAGGGAAGAGGCTGGACTATATCACAGCTGAAATTAAGCGATACGAATCCCAGC
  TTCGGGATCTTGAGCGGCAGTCAGAGCAACAGAGGGAGACCCTTGCTCAGCTGCAGCAGGAGTTCCAGCG
  GGCCCAGGCAGCAAAGGCAGGGGCTCCTGGCAAGGCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001185181
• ORF Size: 390 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001185181.2, NP_001172110.1
• RefSeq Size: 705
• RefSeq ORF: 390
• Locus ID: 10471
• Protein Families: Stem cell - Pluripotency
• Gene Summary: PFDN6 is a subunit of the heteromeric prefoldin complex that chaperones nascent actin (see MIM 102560) and alpha- and beta-tubulin (see MIM 602529 and MIM 191130, respectively) chains pending their transfer to the cytosolic chaperonin containing TCP1 (MIM 186980) (CCT) complex (Hansen et al., 1999 [PubMed 10209023]). [supplied by OMIM, Jul 2010]
  Transcript Variant: This variant (1) represents the longest transcript. All variants encode the same protein.