C1D (NM_001190265) Human Untagged Clone

CAT#: SC329417

C1D (untagged) - Homo sapiens C1D nuclear receptor corepressor (C1D), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: C1D
• Synonyms: hC1D; LRP1; Rrp47; SUN-CoR; SUNCOR
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001190265, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCAGGTGAAGAAATTAATGAAGACTATCCAGTAGAAATTCACGAGTATTTGTCAGCGTTTGAGAATT
  CCATTGGTGCTGTGGATGAGATGCTGAAGACCATGATGTCTGTTTCTAGAAATGAGTTGTTGCAGAAGTT
  GGATCCACTTGAACAAGCAAAAGTGGATTTGGTTTCTGCATACACATTAAATTCAATGTTTTGGGTTTAT
  TTGGCAACCCAAGGAGTTAATCCTAAGGAACATCCAGTAAAACAGGAATTGGAAAGAATCAGAGTATATA
  TGAACAGAGTCAAGGAAATAACAGACAAGAAAAAGGCTGGCAAGCTGGACAGAGGTGCAGCTTCAAGATT
  TGTAAAAAATGCCCTCTGGGAACCAAAATCGAAAAATGCATCAAAAGTTGCCAATAAAGGAAAAAGTAAA
  AGTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001190265
• ORF Size: 426 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001190265.1, NP_001177194.1
• RefSeq Size: 1294
• RefSeq ORF: 426
• Locus ID: 10438
• Protein Families: Druggable Genome
• Protein Pathways: RNA degradation
• Gene Summary: The protein encoded by this gene is a DNA binding and apoptosis-inducing protein and is localized in the nucleus. It is also a Rac3-interacting protein which acts as a corepressor for the thyroid hormone receptor. This protein is thought to regulate TRAX/Translin complex formation. Alternate splicing results in multiple transcript variants that encode the same protein. Multiple pseudogenes of this gene are found on chromosome 10. [provided by RefSeq, Jun 2010]
  Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3 and 4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.