MSRB3 (NM_001193460) Human Untagged Clone

CAT#: SC329432

MSRB3 (untagged) - Homo sapiens methionine sulfoxide reductase B3 (MSRB3), transcript variant 3


  "NM_001193460" in other vectors (2)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "MSRB3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MSRB3
Synonyms DFNB74
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001193460, the custom clone sequence may differ by one or more nucleotides


ATGTCTGCATTCAACCTGCTGCATTTGGTGACAAAGAGCCAGCCAGTAGCCCTTCGAGCCTGTGGGCTTC
CCTCAGGGTCGTGTAGGGATAAAAAGAACTGTAAGGTGGTCTTTTCCCAGCAGGAACTGAGGAAGCGGCT
AACACCCCTGCAGTACCATGTCACTCAGGAGAAAGGGACCGAAAGTGCCTTTGAAGGAGAATACACACAT
CACAAAGATCCTGGAATATATAAATGTGTTGTTTGTGGAACTCCATTGTTTAAGTCAGAAACCAAATTTG
ACTCCGGTTCAGGTTGGCCTTCATTCCACGATGTGATCAATTCTGAGGCAATCACATTCACAGATGACTT
TTCCTATGGGATGCACAGGGTGGAAACAAGCTGCTCTCAGTGTGGTGCTCACCTTGGGCACATTTTTGAT
GATGGGCCTCGTCCAACTGGGAAAAGATACTGCATAAATTCGGCTGCCTTGTCTTTTACACCTGCGGATA
GCAGTGGCACCGCCGAGGGAGGCAGTGGGGTCGCCAGCCCGGCCCAGGCAGACAAAGCGGAGCTCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001193460
ORF Size 558 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001193460.1, NP_001180389.1
RefSeq Size 4598
RefSeq ORF 558
Locus ID 253827
Gene Summary The protein encoded by this gene catalyzes the reduction of methionine sulfoxide to methionine. This enzyme acts as a monomer and requires zinc as a cofactor. Several transcript variants encoding two different isoforms have been found for this gene. One of the isoforms localizes to mitochondria while the other localizes to endoplasmic reticula. [provided by RefSeq, Jul 2010]
Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1. Variants 2, 3, and 4 all encode isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.