MSRB3 (NM_001193461) Human Untagged Clone

CAT#: SC329433

MSRB3 (untagged) - Homo sapiens methionine sulfoxide reductase B3 (MSRB3), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MSRB3
• Synonyms: DFNB74
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001193461, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCTGCATTCAACCTGCTGCATTTGGTGACAAAGAGCCAGCCAGTAGCCCTTCGAGCCTGTGGGCTTC
  CCTCAGGGTCGTGTAGGGATAAAAAGAACTGTAAGGTGGTCTTTTCCCAGCAGGAACTGAGGAAGCGGCT
  AACACCCCTGCAGTACCATGTCACTCAGGAGAAAGGGACCGAAAGTGCCTTTGAAGGAGAATACACACAT
  CACAAAGATCCTGGAATATATAAATGTGTTGTTTGTGGAACTCCATTGTTTAAGTCAGAAACCAAATTTG
  ACTCCGGTTCAGGTTGGCCTTCATTCCACGATGTGATCAATTCTGAGGCAATCACATTCACAGATGACTT
  TTCCTATGGGATGCACAGGGTGGAAACAAGCTGCTCTCAGTGTGGTGCTCACCTTGGGCACATTTTTGAT
  GATGGGCCTCGTCCAACTGGGAAAAGATACTGCATAAATTCGGCTGCCTTGTCTTTTACACCTGCGGATA
  GCAGTGGCACCGCCGAGGGAGGCAGTGGGGTCGCCAGCCCGGCCCAGGCAGACAAAGCGGAGCTCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001193461
• ORF Size: 558 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001193461.1, NP_001180390.1
• RefSeq Size: 4296
• RefSeq ORF: 558
• Locus ID: 253827
• Gene Summary: The protein encoded by this gene catalyzes the reduction of methionine sulfoxide to methionine. This enzyme acts as a monomer and requires zinc as a cofactor. Several transcript variants encoding two different isoforms have been found for this gene. One of the isoforms localizes to mitochondria while the other localizes to endoplasmic reticula. [provided by RefSeq, Jul 2010]
  Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1. Variants 2, 3, and 4 all encode isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.