DDIT3 (NM_001195054) Human Untagged Clone
CAT#: SC329445
DDIT3 (untagged) - Homo sapiens DNA-damage-inducible transcript 3 (DDIT3), transcript variant 2
"NM_001195054" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "DDIT3"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DDIT3 |
Synonyms | AltDDIT3; C/EBPzeta; CEBPZ; CHOP; CHOP-10; CHOP10; GADD153 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001195054, the custom clone sequence may differ by one or more nucleotides
ATGGAGCTTGTTCCAGCCACTCCCCATTATCCTGCAGATGTGCTTTTCCAGACTGATCCAACTGCAGAGA TGGCAGCTGAGTCATTGCCTTTCTCCTTCGGGACACTGTCCAGCTGGGAGCTGGAAGCCTGGTATGAGGA CCTGCAAGAGGTCCTGTCTTCAGATGAAAATGGGGGTACCTATGTTTCACCTCCTGGAAATGAAGAGGAA GAATCAAAAATCTTCACCACTCTTGACCCTGCTTCTCTGGCTTGGCTGACTGAGGAGGAGCCAGAACCAG CAGAGGTCACAAGCACCTCCCAGAGCCCTCACTCTCCAGATTCCAGTCAGAGCTCCCTGGCTCAGGAGGA AGAGGAGGAAGACCAAGGGAGAACCAGGAAACGGAAACAGAGTGGTCATTCCCCAGCCCGGGCTGGAAAG CAGCGCATGAAGGAGAAAGAACAGGAGAATGAAAGGAAAGTGGCACAGCTAGCTGAAGAGAATGAACGGC TCAAGCAGGAAATCGAGCGCCTGACCAGGGAAGTAGAGGCGACTCGCCGAGCTCTGATTGACCGAATGGT GAATCTGCACCAAGCATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001195054 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001195054.1, NP_001181983.1 |
RefSeq Size | 1028 bp |
RefSeq ORF | 579 bp |
Locus ID | 1649 |
Cytogenetics | 12q13.3 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | MAPK signaling pathway |
Gene Summary | 'This gene encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. The protein functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members, such as C/EBP and LAP (liver activator protein), and preventing their DNA binding activity. The protein is implicated in adipogenesis and erythropoiesis, is activated by endoplasmic reticulum stress, and promotes apoptosis. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in myxoid liposarcomas or Ewing sarcoma. Multiple alternatively spliced transcript variants encoding two isoforms with different length have been identified. [provided by RefSeq, Aug 2010]' Transcript Variant: This variant (2) lacks an internal segment in the 5' UTR, as compared to variant 1. Variants 1-4 encode the same isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.