ARL4 (ARL4A) (NM_001195396) Human Untagged Clone
CAT#: SC329455
ARL4A (untagged) - Homo sapiens ADP-ribosylation factor-like 4A (ARL4A), transcript variant 4
"NM_001195396" in other vectors (2)
Product Images
Other products for "ARL4A"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ARL4A |
Synonyms | ARL4 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001195396, the custom clone sequence may differ by one or more nucleotides
ATGGGGAATGGGCTGTCAGACCAGACTTCTATCCTGTCCAACCTGCCTTCATTTCAGTCTTTCCACATTG TTATTCTGGGTTTGGACTGTGCTGGAAAGACAACTGTCTTATACAGGCTGCAGTTCAATGAATTTGTAAA TACCGTACCTACCAAAGGATTTAACACTGAGAAAATTAAGGTAACCTTGGGAAATTCTAAAACAGTCACT TTTCACTTCTGGGATGTAGGTGGTCAGGAGAAATTAAGGCCACTGTGGAAGTCATATACCAGATGCACAG ATGGCATTGTATTTGTTGTGGACTCTGTTGATGTCGAAAGGATGGAAGAAGCCAAAACTGAACTTCACAA AATAACTAGGATATCAGAAAATCAGGGAGTCCCTGTACTTATAGTTGCTAACAAACAAGATTTGAGGAAC TCATTGTCACTTTCAGAAATTGAGAAATTGTTAGCAATGGGTGAACTGAGCTCATCAACTCCTTGGCATT TGCAGCCTACCTGTGCAATCATAGGAGATGGCCTAAAGGAAGGACTTGAGAAACTACATGATATGATCAT TAAAAGAAGAAAAATGTTGCGGCAACAGAAAAAGAAAAGATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001195396 |
ORF Size | 603 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001195396.1, NP_001182325.1 |
RefSeq Size | 3209 |
RefSeq ORF | 603 |
Locus ID | 10124 |
Protein Families | Stem cell - Pluripotency |
Gene Summary | ADP-ribosylation factor-like 4A is a member of the ADP-ribosylation factor family of GTP-binding proteins. ARL4A is similar to ARL4C and ARL4D and each has a nuclear localization signal and an unusually high guaninine nucleotide exchange rate. ARL4A is located in both the nuclear and extranuclear cell compartments. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. All four variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.