ARL4 (ARL4A) (NM_001195396) Human Untagged Clone

CAT#: SC329455

ARL4A (untagged) - Homo sapiens ADP-ribosylation factor-like 4A (ARL4A), transcript variant 4


  "NM_001195396" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ARL4A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ARL4A
Synonyms ARL4
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001195396, the custom clone sequence may differ by one or more nucleotides


ATGGGGAATGGGCTGTCAGACCAGACTTCTATCCTGTCCAACCTGCCTTCATTTCAGTCTTTCCACATTG
TTATTCTGGGTTTGGACTGTGCTGGAAAGACAACTGTCTTATACAGGCTGCAGTTCAATGAATTTGTAAA
TACCGTACCTACCAAAGGATTTAACACTGAGAAAATTAAGGTAACCTTGGGAAATTCTAAAACAGTCACT
TTTCACTTCTGGGATGTAGGTGGTCAGGAGAAATTAAGGCCACTGTGGAAGTCATATACCAGATGCACAG
ATGGCATTGTATTTGTTGTGGACTCTGTTGATGTCGAAAGGATGGAAGAAGCCAAAACTGAACTTCACAA
AATAACTAGGATATCAGAAAATCAGGGAGTCCCTGTACTTATAGTTGCTAACAAACAAGATTTGAGGAAC
TCATTGTCACTTTCAGAAATTGAGAAATTGTTAGCAATGGGTGAACTGAGCTCATCAACTCCTTGGCATT
TGCAGCCTACCTGTGCAATCATAGGAGATGGCCTAAAGGAAGGACTTGAGAAACTACATGATATGATCAT
TAAAAGAAGAAAAATGTTGCGGCAACAGAAAAAGAAAAGATGA


Restriction Sites SgfI-MluI     
ACCN NM_001195396
ORF Size 603 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001195396.1, NP_001182325.1
RefSeq Size 3209
RefSeq ORF 603
Locus ID 10124
Protein Families Stem cell - Pluripotency
Gene Summary ADP-ribosylation factor-like 4A is a member of the ADP-ribosylation factor family of GTP-binding proteins. ARL4A is similar to ARL4C and ARL4D and each has a nuclear localization signal and an unusually high guaninine nucleotide exchange rate. ARL4A is located in both the nuclear and extranuclear cell compartments. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. All four variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.