ATP6V0C (NM_001198569) Human Untagged Clone

CAT#: SC329465

ATP6V0C (untagged) - Homo sapiens ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c (ATP6V0C), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATP6V0C
• Synonyms: ATP6C; ATP6L; ATPL; VATL; Vma3; VPPC
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001198569, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCGAGTCCAAGAGCGGCCCCGAGTATGCTTCGTTTTTCGCCGTCATGGGCGCCTCGGCCGCCATGG
  TCTTCAGCGCCCTGGGCGCTGCCTATGGCACAGCCAAGAGCGGTACCGGCATTGCGGCCATGTCTGTCAT
  GCGGCCGGAGCAGATCATGAAGTCCATCATCCCAGTGGTCATGGCTGGCATCATCGCCATCTACGGCCTG
  GTGGTGGCAGTCCTCATCGCCAACTCCCTGAATGACGACATCAGCCTCTACAAGAGCTTCCTCCAGCTGG
  GCGCCGGCCTGAGCGTGGGCCTGAGCGGCCTGGCAGCCGGCTTTGCCATCGGCATCGTGGGGGACGCTGG
  CGTGCGGGGCACCGCCCAGCAGCCCCGACTATTCGTGGGCATGATCCTGATTCTCATCTTCGCCGAGGTG
  CTCGGCCTCTACGGTCTCATCGTCGCCCTCATCCTCTCCACAAAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001198569
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001198569.1, NP_001185498.1
• RefSeq Size: 1021 bp
• RefSeq ORF: 468 bp
• Locus ID: 527
• Cytogenetics: 16p13.3
• Protein Families: Transmembrane
• Protein Pathways: Epithelial cell signaling in Helicobacter pylori infection, Lysosome, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection
• Gene Summary: 'This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. This gene encodes the V0 subunit c. Alternative splicing results in transcript variants. Pseudogenes have been identified on chromosomes 6 and 17. [provided by RefSeq, Nov 2010]'
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.