GNGT2 (NM_001198756) Human Untagged Clone

CAT#: SC329473

GNGT2 (untagged) - Homo sapiens guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 (GNGT2), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GNGT2
• Synonyms: G-GAMMA-8; G-GAMMA-C; GNG8; GNG9; GNGT8
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001198756, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCCAGGATCTCAGCGAGAAGGACCTGTTGAAGATGGAGGTGGAGCAGCTGAAGAAAGAAGTGAAAA
  ACACAAGAATTCCGATTTCCAAAGCGGGAAAGGAAATCAAGGAGTACGTGGAGGCCCAAGCAGGAAACGA
  TCCTTTTCTCAAAGGCATCCCTGAGGACAAGAATCCCTTCAAGGAGAAAGGTGGCTGTCTGATAAGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001198756
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001198756.1, NP_001185685.1
• RefSeq Size: 930 bp
• RefSeq ORF: 210 bp
• Locus ID: 2793
• Cytogenetics: 17q21.32
• Protein Families: Druggable Genome
• Protein Pathways: Chemokine signaling pathway
• Gene Summary: 'Phototransduction in rod and cone photoreceptors is regulated by groups of signaling proteins. The encoded protein is thought to play a crucial role in cone phototransduction. It belongs to the G protein gamma family and localized specifically in cones. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2010]'
  Transcript Variant: This variant (4) differs in the 5' UTR compared to variant 1. All four variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.