Cytochrome P450 2C8 (CYP2C8) (NM_001198855) Human Untagged Clone
CAT#: SC329477
CYP2C8 (untagged) - Homo sapiens cytochrome P450, family 2, subfamily C, polypeptide 8 (CYP2C8), transcript variant 4
"NM_001198855" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CYP2C8 |
Synonyms | CPC8; CYP2C8DM; CYPIIC8; MP-12/MP-20 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001198855, the custom clone sequence may differ by one or more nucleotides
ATGAATCCCATAGTGGTGTTTCATGGATATGAGGCAGTGAAGGAAGCCCTGATTGATAATGGAGAGGAGT TTTCTGGAAGAGGCAATTCCCCAATATCTCAAAGAATTACTAAAGGACTTGGAATCATTTCCAGCAATGG AAAGAGATGGAAGGAGATCCGGCGTTTCTCCCTCACAACCTTGCGGAATTTTGGGATGGGGAAGAGGAGC ATTGAGGACCGTGTTCAAGAGGAAGCTCACTGCCTTGTGGAGGAGTTGAGAAAAACCAAGGCTTCACCCT GTGATCCCACTTTCATCCTGGGCTGTGCTCCCTGCAATGTGATCTGCTCCGTTGTTTTCCAGAAACGATT TGATTATAAAGATCAGAATTTTCTCACCCTGATGAAAAGATTCAATGAAAACTTCAGGATTCTGAACTCC CCATGGATCCAGGTCTGCAATAATTTCCCTCTACTCATTGATTGTTTCCCAGGAACTCACAACAAAGTGC TTAAAAATGTTGCTCTTACACGAAGTTACATTAGGGAGAAAGTAAAAGAACACCAAGCATCACTGGATGT TAACAATCCTCGGGACTTTATCGATTGCTTCCTGATCAAAATGGAGCAGGAAAAGGACAACCAAAAGTCA GAATTCAATATTGAAAACTTGGTTGGCACTGTAGCTGATCTATTTGTTGCTGGAACAGAGACAACAAGCA CCACTCTGAGATATGGACTCCTGCTCCTGCTGAAGCACCCAGAGGTCACAGCTAAAGTCCAGGAAGAGAT TGATCATGTAATTGGCAGACACAGGAGCCCCTGCATGCAGGATAGGAGCCACATGCCTTACACTGATGCT GTAGTGCACGAGATCCAGAGATACAGTGACCTTGTCCCCACCGGTGTGCCCCATGCAGTGACCACTGATA CTAAGTTCAGAAACTACCTCATCCCCAAGGGCACAACCATAATGGCATTACTGACTTCCGTGCTACATGA TGACAAAGAATTTCCTAATCCAAATATCTTTGACCCTGGCCACTTTCTAGATAAGAATGGCAACTTTAAG AAAAGTGACTACTTCATGCCTTTCTCAGCAGGAAAACGAATTTGTGCAGGAGAAGGACTTGCCCGCATGG AGCTATTTTTATTTCTAACCACAATTTTACAGAACTTTAACCTGAAATCTGTTGATGATTTAAAGAACCT CAATACTACTGCAGTTACCAAAGGGATTGTTTCTCTGCCACCCTCATACCAGATCTGCTTCATCCCTGTC TGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001198855 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001198855.1, NP_001185784.1 |
RefSeq Size | 2024 bp |
RefSeq ORF | 1263 bp |
Locus ID | 1558 |
Cytogenetics | 10q23.33 |
Protein Families | Druggable Genome, P450, Transmembrane |
Protein Pathways | Arachidonic acid metabolism, Drug metabolism - cytochrome P450, Linoleic acid metabolism, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Retinol metabolism |
Gene Summary | 'This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by phenobarbital. The enzyme is known to metabolize many xenobiotics, including the anticonvulsive drug mephenytoin, benzo(a)pyrene, 7-ethyoxycoumarin, and the anti-cancer drug taxol. This gene is located within a cluster of cytochrome P450 genes on chromosome 10q24. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]' Transcript Variant: This variant (4) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Variants 2 and 4 both encode the same isoform (b). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232690 | CYP2C8 (Myc-DDK tagged) - Homo sapiens cytochrome P450, family 2, subfamily C, polypeptide 8 (CYP2C8), transcript variant 4 |
USD 440.00 |
|
RG232690 | CYP2C8 (GFP-tagged) - Homo sapiens cytochrome P450, family 2, subfamily C, polypeptide 8 (CYP2C8), transcript variant 4 |
USD 480.00 |
{0} Product Review(s)
Be the first one to submit a review