AK2 (NM_001199199) Human Untagged Clone

CAT#: SC329496

AK2 (untagged) - Homo sapiens adenylate kinase 2 (AK2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: AK2
• Synonyms: ADK2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199199, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTCCCAGCGTGCCAGCGGCAGAACCCGAGTATCCTAAAGGCATCCGGGCCGTGCTGCTGGGGCCTC
  CCGGGGCCGGTAAAGGGACCCAGGCACCCAGATTGGCTGAAAACTTCTGTGTCTGCCATTTAGCTACTGG
  GGACATGCTGAGGGCCATGGTGGCTTCTGGCTCAGAGCTAGGAAAAAAGCTGAAGGCAACTATGGATGCT
  GGGAAACTGGTGAGTGATGAAATGGTAGTGGAGCTCATTGAGAAGAATTTGGAGACCCCCTTGTGCAAAA
  ATGGTTTTCTTCTGGATGGCTTCCCTCGGACTGTGAGGCAGGCAGAAATGCTCGATGACCTCATGGAGAA
  GAGGAAAGAGAAGCTTGATTCTGTGATTGAATTCAGCATCCCAGACTCTCTGCTGATTCACCCCAAGAGT
  GGCCGTTCCTACCACGAGGAGTTCAACCCTCCAAAAGAGCCCATGAAAGATGACATCACCGGGGAACCCT
  TGATCCGTCGATCAGATGATAATGAAAAGGCCTTGAAAATCCGCCTGCAAGCCTACCACACTCAAACCAC
  CCCACTCATAGAGTACTACAGGAAACGGGGGATCCACTCCGCCATCGATGCATCCCAGACCCCCGATGTC
  GTGTTCGCAAGCATCCTAGCAGCCTTCTCCAAAGCCACATCCTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199199
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199199.1, NP_001186128.1
• RefSeq Size: 3647 bp
• RefSeq ORF: 675 bp
• Locus ID: 204
• Cytogenetics: 1p35.1
• Protein Families: Druggable Genome
• Protein Pathways: Metabolic pathways, Purine metabolism
• Gene Summary: 'Adenylate kinases are involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. Three isozymes of adenylate kinase, namely 1, 2, and 3, have been identified in vertebrates; this gene encodes isozyme 2. Expression of these isozymes is tissue-specific and developmentally regulated. Isozyme 2 is localized in the mitochondrial intermembrane space and may play a role in apoptosis. Mutations in this gene are the cause of reticular dysgenesis. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 1 and 2.[provided by RefSeq, Nov 2010]'
  Transcript Variant: This variant (3) uses an alternate in-frame splice junction and differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (c) lacks an alternate internal segment and has a shorter and distinct C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.