STMN2 (NM_001199214) Human Untagged Clone

CAT#: SC329498

STMN2 (untagged) - Homo sapiens stathmin-like 2 (STMN2), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: STMN2
• Synonyms: SCG10; SCGN10
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199214, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTAAAACAGCAATGGCCTACAAGGAAAAAATGAAGGAGCTGTCCATGCTGTCACTGATCTGCTCTT
  GCTTTTACCCGGAACCTCGCAACATCAACATCTATACTTACGATGATATGGAAGTGAAGCAAATCAACAA
  ACGTGCCTCTGGCCAGGCTTTTGAGCTGATCTTGAAGCCACCATCTCCTATCTCAGAAGCCCCACGAACT
  TTAGCTTCTCCAAAGAAGAAAGACCTGTCCCTGGAGGAGATCCAGAAGAAACTGGAGGCTGCAGAGGAAA
  GAAGAAAGTCTCAGGAGGCCCAGGTGCTGAAACAATTGGCAGAGAAGAGGGAACACGAGCGAGAAGTCCT
  TCAGAAGGCTTTGGAGGAGAACAACAACTTCAGCAAGATGGCGGAGGAAAAGCTGATCCTGAAAATGGAA
  CAAATTAAGGAAAACCGTGAGGCTAATCTAGCTGCTATTATTGAACGTCTGCAGGAAAAGCTGGTCAAGT
  TTATTTCTTCTGAACTAAAAGAATCTATAGAGTCTCAATTTCTGGAGCTTCAGAGGGAAGGAGAGAAGCA
  ATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199214
• ORF Size: 564 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001199214.1, NP_001186143.1
• RefSeq Size: 2314
• RefSeq ORF: 564
• Locus ID: 11075
• Gene Summary: This gene encodes a member of the stathmin family of phosphoproteins. Stathmin proteins function in microtubule dynamics and signal transduction. The encoded protein plays a regulatory role in neuronal growth and is also thought to be involved in osteogenesis. Reductions in the expression of this gene have been associated with Down's syndrome and Alzheimer's disease. Alternatively spliced transcript variants have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Nov 2010]
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).