INMT (NM_001199219) Human Untagged Clone
CAT#: SC329500
INMT (untagged) - Homo sapiens indolethylamine N-methyltransferase (INMT), transcript variant 2
"NM_001199219" in other vectors (2)
Product Images
Other products for "INMT"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | INMT |
Synonyms | TEMT |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001199219, the custom clone sequence may differ by one or more nucleotides
ATGAAGGGTGGCTTCACTGGGGGTGATGAGTACCAGAAGCACTTCCTGCCCAGGGACTACTTGGCTACTT ACTACAGCTTCGATGGCAGCCCCTCACCCGAGGCCGAGATGCTGAAGTTTAACTTGGAATGTCTCCACAA GACCTTCGGCCCTGGCCTCCAAGGGGACACGCTGATTGACATTGGCTCAGGTCCTACCATCTACCAAGTT CTTGCTGCCTGTGATTCCTTCCAAGACATCACTCTCTCCGACTTTACCGACCGCAACCGGGAGGAGCTGG AAAAGTGGCTGAAGAAGGAGCCGGGGGCCTATGACTGGACCCCAGCGGTGAAATTCGCCTGTGAGCTGGA AGGAAACAGCGGCCGATGGGAGGAGAAGGAGGAGAAGCTGCGGGCAGCGGTGAAGCGGGTGCTCAAGTGC GATGTCCACCTGGGCAACCCGCTGGCCCCGGCTGTGTTGCCTCTCGCCGACTGTGTGCTCACCCTGCTGG CCATGGAGTGTGCCTGCTGTAGCCTTGATGCCTACCGCGCTGCCCTGTGCAACCTTGCCTCACTGCTCAA GCCGGGTGGCCACCTGGTGACCACTGTCACGCTTCGGCTCCCGTCCTACATGGTGGGGAAGCGTGAATTT TCCTGCGTGGCCCTGGAGAAAGAGGAGGTGGAGCAGGCTGTCCTGGATGCTGGCTTTGACATTGAACAGC TCCTACACAGTCCCCAGAGCTACTCTGTCACCAATGCTGCCAACAATGGGGTCTGCTTCATTGTGGCTCG CAAGAAGCCTGGGCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199219 |
ORF Size | 789 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001199219.1, NP_001186148.1 |
RefSeq Size | 2576 |
RefSeq ORF | 789 |
Locus ID | 11185 |
Protein Pathways | Tryptophan metabolism |
Gene Summary | N-methylation of endogenous and xenobiotic compounds is a major method by which they are degraded. This gene encodes an enzyme that N-methylates indoles such as tryptamine. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream FAM188B (family with sequence similarity 188, member B) gene. [provided by RefSeq, Nov 2010] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1, resulting in an isoform (2) that is 1 aa shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.