INMT (NM_001199219) Human Untagged Clone

CAT#: SC329500

INMT (untagged) - Homo sapiens indolethylamine N-methyltransferase (INMT), transcript variant 2


  "NM_001199219" in other vectors (2)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "INMT"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol INMT
Synonyms TEMT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001199219, the custom clone sequence may differ by one or more nucleotides


ATGAAGGGTGGCTTCACTGGGGGTGATGAGTACCAGAAGCACTTCCTGCCCAGGGACTACTTGGCTACTT
ACTACAGCTTCGATGGCAGCCCCTCACCCGAGGCCGAGATGCTGAAGTTTAACTTGGAATGTCTCCACAA
GACCTTCGGCCCTGGCCTCCAAGGGGACACGCTGATTGACATTGGCTCAGGTCCTACCATCTACCAAGTT
CTTGCTGCCTGTGATTCCTTCCAAGACATCACTCTCTCCGACTTTACCGACCGCAACCGGGAGGAGCTGG
AAAAGTGGCTGAAGAAGGAGCCGGGGGCCTATGACTGGACCCCAGCGGTGAAATTCGCCTGTGAGCTGGA
AGGAAACAGCGGCCGATGGGAGGAGAAGGAGGAGAAGCTGCGGGCAGCGGTGAAGCGGGTGCTCAAGTGC
GATGTCCACCTGGGCAACCCGCTGGCCCCGGCTGTGTTGCCTCTCGCCGACTGTGTGCTCACCCTGCTGG
CCATGGAGTGTGCCTGCTGTAGCCTTGATGCCTACCGCGCTGCCCTGTGCAACCTTGCCTCACTGCTCAA
GCCGGGTGGCCACCTGGTGACCACTGTCACGCTTCGGCTCCCGTCCTACATGGTGGGGAAGCGTGAATTT
TCCTGCGTGGCCCTGGAGAAAGAGGAGGTGGAGCAGGCTGTCCTGGATGCTGGCTTTGACATTGAACAGC
TCCTACACAGTCCCCAGAGCTACTCTGTCACCAATGCTGCCAACAATGGGGTCTGCTTCATTGTGGCTCG
CAAGAAGCCTGGGCCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001199219
ORF Size 789 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001199219.1, NP_001186148.1
RefSeq Size 2576
RefSeq ORF 789
Locus ID 11185
Protein Pathways Tryptophan metabolism
Gene Summary N-methylation of endogenous and xenobiotic compounds is a major method by which they are degraded. This gene encodes an enzyme that N-methylates indoles such as tryptamine. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream FAM188B (family with sequence similarity 188, member B) gene. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1, resulting in an isoform (2) that is 1 aa shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.