NCOA7 (NM_001199622) Human Untagged Clone

CAT#: SC329537

NCOA7 (untagged) - Homo sapiens nuclear receptor coactivator 7 (NCOA7), transcript variant 6


  "NM_001199622" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NCOA7"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NCOA7
Synonyms dJ187J11.3; ERAP140; ESNA1; Nbla00052; Nbla10993; NCOA7-AS; TLDC4
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001199622, the custom clone sequence may differ by one or more nucleotides


ATGAGAGGCCAAAGATTACCCTTGGACATCCAGATTTTCTATTGTGCCAGACCTGACGAAGAGCCTTTTG
TGAAGATCATCACTGTTGAAGAGGCAAAGCGCAGGAAGAGCACATGCAGCTACTATGAAGACGAGGACGA
AGAGGTGCTGCCTGTCCTACGGCCCCACAGCGCGCTCCTGGAGAATATGCACATCGAGCAGCTGGCCCGA
CGCCTTCCTGCAAGGGTGCAAGGGTATCCATGGAGACTGGCCTATAGCACGTTAGAGCACGGGACCAGCT
TAAAGACGCTCTACCGGAAATCGGCATCACTAGACAGTCCTGTCCTATTGGTCATCAAAGATATGGATAA
TCAGATTTTTGGAGCATATGCAACTCATCCTTTCAAGTTCAGTGACCACTATTATGGCACAGGCGAAACT
TTTCTCTACACATTCAGCCCTCATTTTAAGGTCTTTAAGTGGAGTGGAGAAAATTCATACTTTATCAATG
GAGACATAAGTTCTTTAGAACTTGGTGGTGGAGGGGGACGATTTGGTTTATGGCTAGATGCTGATTTATA
CCACGGACGAAGCAACTCTTGCAGCACTTTCAATAATGATATTCTTTCCAAAAAGGAAGACTTCATAGTT
CAGGATCTGGAGGTGTGGGCATTTGATTGA


Restriction Sites SgfI-MluI     
ACCN NM_001199622
ORF Size 660 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001199622.1, NP_001186551.1
RefSeq Size 4052
RefSeq ORF 660
Locus ID 135112
Protein Families Druggable Genome
Gene Summary Enhances the transcriptional activities of several nuclear receptors. Involved in the coactivation of different nuclear receptors, such as ESR1, THRB, PPARG and RARA. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) lacks multiple exons from the 5' end and has an alternate 5' exon, compared to variant 1. The resulting isoform (4) is much shorter and has a distinct N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.