IL33 (NM_001199641) Human Untagged Clone
CAT#: SC329544
IL33 (untagged) - Homo sapiens interleukin 33 (IL33), transcript variant 3
"NM_001199641" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "IL33"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IL33 |
Synonyms | C9orf26; DVS27; IL1F11; NF-HEV; NFEHEV |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001199641, the custom clone sequence may differ by one or more nucleotides
ATGAAGCCTAAAATGAAGTATTCAACCAACAAAATTTCCACAGCAAAGTGGAAGAACACAGCAAGCAAAG CCTTGTGTTTCAAGCTGGGAAATAAGGTGTTACTGAGTTACTATGAGTCTCAACACCCCTCAAATGAATC AGGTGACGGTGTTGATGGTAAGATGTTAATGGTAACCCTGAGTCCTACAAAAGACTTCTGGTTGCATGCC AACAACAAGGAACACTCTGTGGAGCTCCATAAGTGTGAAAAACCACTGCCAGACCAGGCCTTCTTTGTCC TTCATAATATGCACTCCAACTGTGTTTCATTTGAATGCAAGACTGATCCTGGAGTGTTTATAGGTGTAAA GGATAATCATCTTGCTCTGATTAAAGTAGACTCTTCTGAGAATTTGTGTACTGAAAATATCTTGTTTAAG CTCTCTGAAACTTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199641 |
ORF Size | 435 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001199641.1, NP_001186570.1 |
RefSeq Size | 2340 |
RefSeq ORF | 435 |
Locus ID | 90865 |
Protein Families | Secreted Protein |
Protein Pathways | Cytosolic DNA-sensing pathway |
Gene Summary | The protein encoded by this gene is a cytokine that binds to the IL1RL1/ST2 receptor. The encoded protein is involved in the maturation of Th2 cells and the activation of mast cells, basophils, eosinophils and natural killer cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (3) lacks an alternate in-frame segment compared to variant 1. The resulting isoform (c, also known as 3) has the same N- and C-termini but is shorter compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.