IL33 (NM_001199641) Human Untagged Clone

CAT#: SC329544

IL33 (untagged) - Homo sapiens interleukin 33 (IL33), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL33
• Synonyms: C9orf26; DVS27; IL1F11; NF-HEV; NFEHEV
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199641, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGCCTAAAATGAAGTATTCAACCAACAAAATTTCCACAGCAAAGTGGAAGAACACAGCAAGCAAAG
  CCTTGTGTTTCAAGCTGGGAAATAAGGTGTTACTGAGTTACTATGAGTCTCAACACCCCTCAAATGAATC
  AGGTGACGGTGTTGATGGTAAGATGTTAATGGTAACCCTGAGTCCTACAAAAGACTTCTGGTTGCATGCC
  AACAACAAGGAACACTCTGTGGAGCTCCATAAGTGTGAAAAACCACTGCCAGACCAGGCCTTCTTTGTCC
  TTCATAATATGCACTCCAACTGTGTTTCATTTGAATGCAAGACTGATCCTGGAGTGTTTATAGGTGTAAA
  GGATAATCATCTTGCTCTGATTAAAGTAGACTCTTCTGAGAATTTGTGTACTGAAAATATCTTGTTTAAG
  CTCTCTGAAACTTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199641
• ORF Size: 435 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001199641.1, NP_001186570.1
• RefSeq Size: 2340
• RefSeq ORF: 435
• Locus ID: 90865
• Protein Families: Secreted Protein
• Protein Pathways: Cytosolic DNA-sensing pathway
• Gene Summary: The protein encoded by this gene is a cytokine that binds to the IL1RL1/ST2 receptor. The encoded protein is involved in the maturation of Th2 cells and the activation of mast cells, basophils, eosinophils and natural killer cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
  Transcript Variant: This variant (3) lacks an alternate in-frame segment compared to variant 1. The resulting isoform (c, also known as 3) has the same N- and C-termini but is shorter compared to isoform a.