ARL2 (NM_001199745) Human Untagged Clone

CAT#: SC329555

ARL2 (untagged) - Homo sapiens ADP-ribosylation factor-like 2 (ARL2), transcript variant 2


  "NM_001199745" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ARL2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ARL2
Synonyms ARFL2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001199745, the custom clone sequence may differ by one or more nucleotides


ATGGGGCTCCTGACCATTCTGAAGAAGATGAAGCAGAAAGAGCGGGAGCTGCGACTGCTCATGCTTGGCC
TGGACAATGCTGGAAAGACAACCATCCTGAAGAAGTTCAATGGGGAGGACATCGACACCATCTCCCCAAC
GCTGGGCTTCAACATCAAGACCCTGGAGCACCGAGGATTCAAGCTGAACATCTGGGATGTGGGTGGCCAG
AAGTCCCTGCGGTCCTACTGGCGGAACTACTTTGAGAGCACCGATGGCCTCATCTGGGTAGTGGACAGCG
CAGACCGCCAGCGCATGCAGGACTGCCAGCGGGAGCTCCAGAGCCTGCTGGTGGAGGAGGTCCTGGAGCT
GGACTCCATCCGCAGCCACCACTGGTGCATCCAGGGCTGCAGCGCCGTCACCGGGGAGAACCTGCTGCCG
GGCATCGACTGGCTCCTGGATGACATTTCCAGCCGCATTTTCACAGCTGACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001199745
ORF Size 474 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001199745.1, NP_001186674.1
RefSeq Size 912
RefSeq ORF 474
Locus ID 402
Gene Summary This gene encodes a small GTP-binding protein of the RAS superfamily which functions as an ADP-ribosylation factor (ARF). The encoded protein is one of a functionally distinct group of ARF-like genes. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.