AK3 (NM_001199852) Human Untagged Clone

CAT#: SC329576

AK3 (untagged) - Homo sapiens adenylate kinase 3 (AK3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: AK3
• Synonyms: AK3L1; AK6; AKL3L; AKL3L1; FIX
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199852, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGGCGTCCGCGCGGCTGCTGCGAGCGGTGATCATGGGGGCCCCGGGCTCGGGCAAGGGCACCGTGT
  CGTCGCGCATCACTACACACTTCGAGCTGAAGCACCTCTCCAGCGGGGACCTGCTCCGGGACAACATGCT
  GCGGGGCACAGGTTTTCCAAGGACACTTCCACAGGCAGAAGCCCTAGATAGAGCTTATCAGATCGACACA
  GTGATTAACCTGAATGTGCCCTTTGAGGTCATTAAACAACGCCTTACTGCTCGCTGGATTCATCCCGCCA
  GTGGCCGAGTCTATAACATTGAATTCAACCCTCCCAAAACTGTGGGCATTGATGACCTGACTGGGGAGCC
  TCTCATTCAGCGTGAGGATGATAAACCAGAGACGGTTATCAAGAGACTAAAGGCTTATGAAGACCAAACA
  AAGCCAGTCCTGGAATATTACCAGAAAAAAGGGGTGCTGGAAACATTCTCCGGAACAGAAACCAACAAGA
  TTTGGCCCTATGTATATGCTTTCCTACAAACTAAAGTTCCACAAAGAAGCCAGAAAGCTTCAGTTACTCC
  ATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199852
• ORF Size: 564 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001199852.1, NP_001186781.1
• RefSeq Size: 4213
• RefSeq ORF: 564
• Locus ID: 50808
• Protein Families: Druggable Genome
• Protein Pathways: Pyrimidine metabolism
• Gene Summary: The protein encoded by this gene is a GTP:ATP phosphotransferase that is found in the mitochondrial matrix. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.