AK3 (NM_001199853) Human Untagged Clone

CAT#: SC329577

AK3 (untagged) - Homo sapiens adenylate kinase 3 (AK3), transcript variant 3


  "NM_001199853" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AK3
Synonyms AK3L1; AK6; AKL3L; AKL3L1; FIX
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001199853, the custom clone sequence may differ by one or more nucleotides


ATGACTCGGCTGGCCCTTCATGAGCTGAAAAATCTCACCCAGTATAGCTGGCTGTTGGATGGTTTTCCAA
GGACACTTCCACAGGCAGAAGCCCTAGATAGAGCTTATCAGATCGACACAGTGATTAACCTGAATGTGCC
CTTTGAGGTCATTAAACAACGCCTTACTGCTCGCTGGATTCATCCCGCCAGTGGCCGAGTCTATAACATT
GAATTCAACCCTCCCAAAACTGTGGGCATTGATGACCTGACTGGGGAGCCTCTCATTCAGCGTGAGGATG
ATAAACCAGAGACGGTTATCAAGAGACTAAAGGCTTATGAAGACCAAACAAAGCCAGTCCTGGAATATTA
CCAGAAAAAAGGGGTGCTGGAAACATTCTCCGGAACAGAAACCAACAAGATTTGGCCCTATGTATATGCT
TTCCTACAAACTAAAGTTCCACAAAGAAGCCAGAAAGCTTCAGTTACTCCATGA


Restriction Sites SgfI-MluI     
ACCN NM_001199853
ORF Size 474 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001199853.1, NP_001186782.1
RefSeq Size 4032
RefSeq ORF 474
Locus ID 50808
Protein Families Druggable Genome
Protein Pathways Pyrimidine metabolism
Gene Summary The protein encoded by this gene is a GTP:ATP phosphotransferase that is found in the mitochondrial matrix. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (c) is shorter at the N-terminus compared to isoform a. Variants 3, 5, and 6 all encode the same isoform (c). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.