Kv beta 2 (KCNAB2) (NM_001199861) Human Untagged Clone

CAT#: SC329581

KCNAB2 (untagged) - Homo sapiens potassium voltage-gated channel, shaker-related subfamily, beta member 2 (KCNAB2), transcript variant 4


  "NM_001199861" in other vectors (2)

Reconstitution Protocol

USD 370.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNAB2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KCNAB2
Synonyms AKR6A5; HKvbeta2; HKvbeta2.1; HKvbeta2.2; KCNA2B; KV-BETA-2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001199861, the custom clone sequence may differ by one or more nucleotides


ATGTATCCAGAATCAACGACGGGCTCCCCGGCTCGGCTCTCGCTGCGGCAGACGGGCTCCCCCGGGATGA
TCTACAGTACTCGGTATGGGAGTCCCAAAAGACAGCTCCAGTTTTACAGGAACCTGGGCAAGTCTGGCCT
GCGGGTCTCCTGCCTGGGACTTGGAACATGGGTGACCTTCGGAGGCCAGATCACCGATGAGATGGCAGAG
CAGCTCATGACCTTGGCCTATGATAATGGCATCAACCTCTTCGATACAGCAGAAGTCTACGCAGCCGGCA
AGGCTGAAGTGGTACTGGGAAACATCATTAAGAAGAAAGGATGGAGGCGGTCCAGCCTCGTCATCACCAC
CAAGATCTTCTGGGGCGGAAAGGCGGAGACGGAGCGGGGCCTGTCCAGGAAGCACATAATCGAAGGTCTG
AAAGCTTCCCTGGAGCGACTGCAGCTGGAGTACGTGGATGTGGTGTTTGCCAACCGCCCGGACCCCAACA
CCCCGATGGAAGAGACCGTCCGCGCCATGACCCACGTCATCAACCAGGGGATGGCCATGTACTGGGGCAC
GTCACGCTGGAGCTCCATGGAGATCATGGAGGCCTACTCCGTGGCCCGGCAGTTCAACCTGACCCCGCCC
ATCTGCGAGCAGGCTGAGTACCACATGTTCCAGCGTGAGAAAGTGGAGGTGCAGCTGCCGGAGCTGTTCC
ACAAGATAGGAGTGGGCGCCATGACCTGGTCCCCTCTGGCCTGTGGCATTGTTTCTGGCAAGTACGACAG
TGGCATCCCACCCTACTCAAGAGCCTCCTTGAAGGGCTACCAGTGGCTGAAGGACAAGATCCTCAGTGAG
GAGGGCCGGCGCCAGCAAGCCAAGCTGAAGGAGCTGCAGGCCATCGCCGAGCGCCTGGGCTGCACCCTGC
CCCAGCTGGCCATAGCCTGGTGCCTGAGGAATGAGGGAGTCAGCTCCGTGCTCCTGGGGGCCTCCAATGC
GGACCAGCTCATGGAGAACATTGGGGCAATACAGGTCCTTCCGAAACTGTCATCTTCCATTATCCACGAG
ATTGATAGTATTTTGGGCAATAAACCCTACAGCAAAAAGGACTACAGATCCTAA


Restriction Sites SgfI-MluI     
ACCN NM_001199861
ORF Size 1104 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001199861.1, NP_001186790.1
RefSeq Size 4282
RefSeq ORF 1104
Locus ID 8514
Protein Families Druggable Genome, Ion Channels: Other
Gene Summary Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member is one of the beta subunits, which are auxiliary proteins associating with functional Kv-alpha subunits. This member alters functional properties of the KCNA4 gene product. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (4) has an alternate 5' UTR exon and encodes the same isoform 1, as compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.