Kv beta 2 (KCNAB2) (NM_001199863) Human Untagged Clone

CAT#: SC329583

KCNAB2 (untagged) - Homo sapiens potassium voltage-gated channel, shaker-related subfamily, beta member 2 (KCNAB2), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KCNAB2
• Synonyms: AKR6A5; HKvbeta2; HKvbeta2.1; HKvbeta2.2; KCNA2B; KV-BETA-2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199863, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCAGAGCAGCTCATGACCTTGGCCTATGATAATGGCATCAACCTCTTCGATACAGCAGAAGTCTACG
  CAGCCGGCAAGGCTGAAGTGGTACTGGGAAACATCATTAAGAAGAAAGGATGGAGGCGGTCCAGCCTCGT
  CATCACCACCAAGATCTTCTGGGGCGGAAAGGCGGAGACGGAGCGGGGCCTGTCCAGGAAGCACATAATC
  GAAGGTCTGAAAGCTTCCCTGGAGCGACTGCAGCTGGAGTACGTGGATGTGGTGTTTGCCAACCGCCCGG
  ACCCCAACACCCCGATGGAAGAGACCGTCCGCGCCATGACCCACGTCATCAACCAGGGGATGGCCATGTA
  CTGGGGCACGTCACGCTGGAGCTCCATGGAGATCATGGAGGCCTACTCCGTGGCCCGGCAGTTCAACCTG
  ACCCCGCCCATCTGCGAGCAGGCTGAGTACCACATGTTCCAGCGTGAGAAAGTGGAGGTGCAGCTGCCGG
  AGCTGTTCCACAAGATAGGAGTGGGCGCCATGACCTGGTCCCCTCTGGCCTGTGGCATTGTTTCTGGCAA
  GTACGACAGTGGCATCCCACCCTACTCAAGAGCCTCCTTGAAGGGCTACCAGTGGCTGAAGGACAAGATC
  CTCAGTGAGGAGGGCCGGCGCCAGCAAGCCAAGCTGAAGGAGCTGCAGGCCATCGCCGAGCGCCTGGGCT
  GCACCCTGCCCCAGCTGGCCATAGCCTGGTGCCTGAGGAATGAGGGAGTCAGCTCCGTGCTCCTGGGGGC
  CTCCAATGCGGACCAGCTCATGGAGAACATTGGGGCAATACAGGTCCTTCCGAAACTGTCATCTTCCATT
  ATCCACGAGATTGATAGTATTTTGGGCAATAAACCCTACAGCAAAAAGGACTACAGATCCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199863
• ORF Size: 903 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001199863.1, NP_001186792.1
• RefSeq Size: 3690
• RefSeq ORF: 903
• Locus ID: 8514
• Protein Families: Druggable Genome, Ion Channels: Other
• Gene Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member is one of the beta subunits, which are auxiliary proteins associating with functional Kv-alpha subunits. This member alters functional properties of the KCNA4 gene product. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2010]
  Transcript Variant: This variant (6) lacks three exons from the 5' end and contains an alternate 5' exon, resulting in a downstream AUG start codon, as compared to variant 1. The resulting isoform (4) has a shorter N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.