IL7 (NM_001199886) Human Untagged Clone

CAT#: SC329589

IL7 (untagged) - Homo sapiens interleukin 7 (IL7), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL7
• Synonyms: IL-7
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001199886, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTCCATGTTTCTTTTAGGTATATCTTTGGACTTCCTCCCCTGATCCTTGTTCTGTTGCCAGTAGCAT
  CATCTGATTGTGATATTGAAGGTAAAGATGGCAAACAATATGAGAGTGTTCTAATGGTCAGCATCGATCA
  ATTATTGGACAGCATGAAAGAAATTGGTAGCAATTGCCTGAATAATGAATTTAACTTTTTTAAAAGACAT
  ATCTGTGATGCTAATAAGGTTAAAGGAAGAAAACCAGCTGCCCTGGGTGAAGCCCAACCAACAAAGAGTT
  TGGAAGAAAATAAATCTTTAAAGGAACAGAAAAAACTGAATGACTTGTGTTTCCTAAAGAGACTATTACA
  AGAGATAAAAACTTGTTGGAATAAAATTTTGATGGGCACTAAAGAACACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199886
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001199886.1, NP_001186815.1
• RefSeq Size: 1957 bp
• RefSeq ORF: 402 bp
• Locus ID: 3574
• Cytogenetics: 8q21.13
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway
• Gene Summary: 'The protein encoded by this gene is a cytokine important for B and T cell development. This cytokine and the hepatocyte growth factor (HGF) form a heterodimer that functions as a pre-pro-B cell growth-stimulating factor. IL7 is found to be a cofactor for V(D)J rearrangement of the T cell receptor beta (TCRB) during early T cell development. This cytokine can be produced locally by intestinal epithelial and epithelial goblet cells, and may serve as a regulatory factor for intestinal mucosal lymphocytes. IL7 plays an essential role in lymphoid cell survival, and in the maintenance of naive and memory T cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their presence in normal tissues has not been confirmed. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection can be a potent inducer of proinflammatory cytokines and chemokines which may defend against the infection, but may also mediate destructive lung injury. Elevated serum IL7 levels, together with several other circulating cytokines and chemokines, has been found to be associated with the severity of Coronavirus Disease 19 (COVID-19). [provided by RefSeq, Jul 2020]'
  Transcript Variant: This variant (2) lacks an in-frame exon in the 3' coding region, compared to variant 1, which results in a shorter isoform (2) compared to isoform 1.